| NBRP Rat No: 0976 |
Strain name: LE-Tg(Drd2-cre)490-9Koba |
Commmon Name: |
Rat Genome Database |
| Principal Investigator: |
Kazuto Kobayashi Fukushima Medical University 1 Hikarigaoka Fukushima-shi 960-1295 Fukushima Japan |
| Tel: 024-547-1667 Fax: 024-548-3936 |
Email: kazuto@fmu.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
|
| Inbred Generations |
F17 (July 2022) |
| Usage Restrictions |
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The RECIPIENT requires a collaboration with the DEPOSITOR. Consult with the DEPOSITOR about details beforehand. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
cre: cre recombinase protein, drd2 |
| Origin |
Background strain: Long-Evans rat (Iar:Long-Evans)
This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Drd2 gene) into Long-Evans rat's fertile eggs. |
| Strain characteristics |
Transgenic rat. This strain expresses Cre recombinase under control of Drd2 promoter. |
| Breeding Conditions |
Maintained by mating heterozygous rats with Long-Evans rats. Good breeding performance. |
| Genotyping |
Identification of cre sequence by PCR. primers...F:TCGATGCAACGAGTGATGAG R:TTCGGCTATACGTAACAGGG, PCR condition (TaKaRa Taq): 94℃ 5min, 94℃ (30cycle) 20s, 56℃ 30s, 72℃ 30s, 4℃. product size：482bp |
| References |
Monitoring and Updating of Action Selection for Goal-Directed Behavior through the Striatal Direct and Indirect Pathways. Nonomura S, Nishizawa K, Sakai Y, Kawaguchi Y, Kato S, Uchigashima M, Watanabe M, Yamanaka K, Enomoto K, Chiken S, Sano H, Soma S, Yoshida J, Samejima K, Ogawa M, Kobayashi K, Nambu A, Isomura Y, Kimura M. Neuron. 2018 Sep 19;99(6):1302-1314.e5. doi: 10.1016/j.neuron.2018.08.002. Epub 2018 Aug 23. PMID: 30146299 |
| Additional strain information |
|
|