Strain information
 NBRP Rat No: 0971  Strain name: LE;LEH-Ednrbsl/Kwb  Commmon Name: LEH-Ednrbsl, LEH.AR-Ednrbsl/Hkv Rat Genome Database
Principal Investigator:  Hiromi Ariki  Kidswell Bio Corporation       Kita 21, Nishi 11, Kita-ku, Sapporo, Hokkaido    0010021 Hokkaido     Japan
Tel: 0117687825    Fax: 0117687826 Email: hiromi.ariki@kidswellbio.com
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白黒、頭巾斑
Inbred Generations  N1
Usage Restrictions  
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected endothelin receptor type B: Ednrb
Origin LEH/Hkv (NBRP Rat No. 0802) was resuscitated from frozen embryos and heterozygous male was obtained. The heterozygous male was mated with female Long-Evans rats (Crlj:LE), and the resulting offspring were deposited.
Strain characteristics Homozygous (sl/sl) rats show auditory disorder and die of megacolon.
Breeding Conditions Maintained as heterozygous.
Genotyping Forward Primer: CCTCCTGGACTAGAGGTTCC, Reverse Primer: ACGACTTAGAAAGCTACACT Product size wild-type:511 bp, mutant:210 bp
References
Additional strain information