Strain information
 NBRP Rat No: 0968  Strain name: SD-Fosem1Yossi  Commmon Name: c-Fos KO rat Rat Genome Database
Principal Investigator:  Yuki Yoshimura / Satoshi Koba  Tottori University       Nishi-cho 86, Yonago, Tottori    683-8503 Tottori     Japan
Tel: 0859-38-6033    Fax: 0859-38-6030 Email:  yoshimura@tottori-u.ac.jp skoba@tottori-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino
Inbred Generations  
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Generation of c-Fos knockout rats, and observation of their phenotype.
Yoshimura Y, Nakamura K, Seno M, Mochizuki M, Kawai K, Koba S, Watanabe T.Exp Anim. 2022 Oct 11. doi:10.1538/expanim.22-0077.
Tha availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for-profit institution for a not-for-profit research.
For use of the BIOLOGICAL RESOURCE by a for-profit institution, the RECIPIENT must reach agreement on terms and conditions of use of it with DEPOSITOR and must obtain a prior written consent from the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected c-Fos
Origin SD rats (Slc:SD) in which the c-Fos gene (ENSRNOG00000008015) was disrupted by the CRISPR/Cas9 system. Two guide RNAs and Cas9 protein were injected into the pronucleus of fertilized eggs of SD rats. After injection, they were transferred into the oviducts of the recipient rats and born. The founder rat (line 12) showed abnormal teeth, and PCR and sequencing analysis revealed that 1,067 bases including Exon 1 were deleted. The founder rat were mated with SD rats and bred.
Strain characteristics Both male and female c-Fos KO rats are small and underweight. They have underdeveloped teeth and also show anomalies in bones. Because of their underdeveloped teeth, they should be fed a powdered diet. Males are sexually mature and viable offspring (females are unknown).
Breeding Conditions Maintained as heterozygous.
Genotyping Determined by PCR (KODFXNeo, TOYOBO). Primers WT F：5'- gactcgctaactagagcctgggagg, R：5'- cctgaattccgcagctcagcctttc, product 285 bp KO F：5'- ggcgagctgttcccgtcaatccc, R：5'- gtccagaatcgctactcacctgctctac, product 605 bp Conditions (94℃, 2 min) → (98℃, 10 sec → 68℃, 30 sec) x 35 times → 12℃, ∞
References Generation of c-Fos knockout rats, and observation of their phenotype.
Yoshimura Y, Nakamura K, Seno M, Mochizuki M, Kawai K, Koba S, Watanabe T.
Exp Anim. 2022 Oct 11. doi: 10.1538/expanim.22-0077.
Additional strain information