| NBRP Rat No: 0968 |
Strain name: SD-Fosem1Yossi |
Commmon Name: c-Fos KO rat |
Rat Genome Database |
| Principal Investigator: |
Yuki Yoshimura / Satoshi Koba Tottori University Nishi-cho 86, Yonago, Tottori 683-8503 Tottori Japan |
| Tel: 0859-38-6033 Fax: 0859-38-6030 |
Email: yoshimura@tottori-u.ac.jp skoba@tottori-u.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
albino |
| Inbred Generations |
|
| Usage Restrictions |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Generation of c-Fos knockout rats, and observation of their phenotype. Yoshimura Y, Nakamura K, Seno M, Mochizuki M, Kawai K, Koba S, Watanabe T.Exp Anim. 2022 Oct 11. doi:10.1538/expanim.22-0077. Tha availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for-profit institution for a not-for-profit research. For use of the BIOLOGICAL RESOURCE by a for-profit institution, the RECIPIENT must reach agreement on terms and conditions of use of it with DEPOSITOR and must obtain a prior written consent from the DEPOSITOR. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
c-Fos |
| Origin |
SD rats (Slc:SD) in which the c-Fos gene (ENSRNOG00000008015) was disrupted by the CRISPR/Cas9 system. Two guide RNAs and Cas9 protein were injected into the pronucleus of fertilized eggs of SD rats. After injection, they were transferred into the oviducts of the recipient rats and born. The founder rat (line 12) showed abnormal teeth, and PCR and sequencing analysis revealed that 1,067 bases including Exon 1 were deleted. The founder rat were mated with SD rats and bred. |
| Strain characteristics |
Both male and female c-Fos KO rats are small and underweight. They have underdeveloped teeth and also show anomalies in bones. Because of their underdeveloped teeth, they should be fed a powdered diet. Males are sexually mature and viable offspring (females are unknown). |
| Breeding Conditions |
Maintained as heterozygous. |
| Genotyping |
Determined by PCR (KODFXNeo, TOYOBO).
Primers
WT F:5'- gactcgctaactagagcctgggagg, R:5'- cctgaattccgcagctcagcctttc, product 285 bp
KO F:5'- ggcgagctgttcccgtcaatccc, R:5'- gtccagaatcgctactcacctgctctac, product 605 bp
Conditions
(94℃, 2 min) → (98℃, 10 sec → 68℃, 30 sec) x 35 times → 12℃, ∞ |
| References |
Generation of c-Fos knockout rats, and observation of their phenotype.
Yoshimura Y, Nakamura K, Seno M, Mochizuki M, Kawai K, Koba S, Watanabe T.
Exp Anim. 2022 Oct 11. doi: 10.1538/expanim.22-0077. |
| Additional strain information |
|
|