Strain information
 NBRP Rat No: 0979  Strain name: SD-C5ar1em22Taoki  Commmon Name: Rat Genome Database
Principal Investigator:  Tomohiro Aoki  The Jikei University School of Medicine       Building F, 3rd floor, 3-25-8, Nishi-shinbashi Minato-ku,    105-8461 Tokyo     Japan
Tel: 03-3433-1111    Fax:  Email: tomoaoki@jikei.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  8
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
(Under Review)
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for profit organization.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected C5ar1
Origin This strain was established by CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. guide RNA gRNA No1; ATAAGTAACGACAGCAGTGA gRNA No2; GAGTTTCACTCGGTCCACGA
Strain characteristics No abnormalities under normal care.
Breeding Conditions Maintained by mating between homozygous rats.
Genotyping Determined by PCR. Using KOD Plus DNA polymerase (Toyobo). 95°C for 2 min ⇒ (98°C for 10 sec ⇒ 68°C for 15 sec) X 35 cycles ⇒ 68°C for 1 min ⇒ 4°C Primers 5'-GGTTCTTCAGTATCCCTTGGTAGTGCTGAG-3' and 5'-GGGAGCAGCTAGGCAGTTGTGGC-3' Band size Wild type 1,198 b.p. Mutant allele 180 b.p.
References 未公表
Additional strain information