Strain information
 NBRP Rat No: 0975  Strain name: W-Gpr143em19Gosh  Commmon Name: Gpr143 KO Rat Genome Database
Principal Investigator:  Yoshio Goshima  Yokohama City University       3-9 Fukuura, Kanazawa-ku, Yokohama, Kanagawa    236-0004 Kanagawa     Japan
Tel: 045-787-2595    Fax: 045-785-3645 Email: goshima@yokohama-cu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白色
Inbred Generations  
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Right ventricular overloading is attenuated in monocrotaline-induced pulmonary hypertension model rats with a disrupted Gpr143 gene, the gene that encodes the 3,4-l-dihydroxyphenyalanine(l-DOPA) receptor.
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
For the first two years after deposit, the RECIPIENT requires a collaboration with the DEPOSITOR. Consult with the DEPOSITOR about details boforehand.
The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial uses based
on the results from the use of the BIOLOGICAL RSOURCE.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Rattus norvegicus G protein-coupled receptor 143 (Gpr143)
Origin Deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. Line No. is 19.
Strain characteristics
Breeding Conditions Maintained by natural mating.
Genotyping Primers: Forward: gaggtaaggaaggcctggtggatggag Reverse: ctgctctgcacccaagggtcactcac PCR conditions: 95°C 2min, 95°C 30s, 58°C 30s, 72°C 1min, 30 cycles WT 657 bp, KO 413 bp
References Nakano et al., Right ventricular overloading is attenuated in monocrotaline-induced pulmonary hypertension model rats with a disrupted Gpr143 gene, the gene that encodes the 3,4-L-dihydroxyphenyalanine (L-DOPA) receptor., J Pharmacol Sci., 2021
Additional strain information