| NBRP Rat No: 0975 |
Strain name: W-Gpr143em19Gosh |
Commmon Name: Gpr143 KO |
Rat Genome Database |
| Principal Investigator: |
Yoshio Goshima Yokohama City University 3-9 Fukuura, Kanazawa-ku, Yokohama, Kanagawa 236-0004 Kanagawa Japan |
| Tel: 045-787-2595 Fax: 045-785-3645 |
Email: goshima@yokohama-cu.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白色 |
| Inbred Generations |
|
| Usage Restrictions |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Right ventricular overloading is attenuated in monocrotaline-induced pulmonary hypertension model rats with a disrupted Gpr143 gene, the gene that encodes the 3,4-l-dihydroxyphenyalanine(l-DOPA) receptor. The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. For the first two years after deposit, the RECIPIENT requires a collaboration with the DEPOSITOR. Consult with the DEPOSITOR about details boforehand. The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial uses based on the results from the use of the BIOLOGICAL RSOURCE. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Rattus norvegicus G protein-coupled receptor 143 (Gpr143) |
| Origin |
Deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. Line No. is 19. |
| Strain characteristics |
|
| Breeding Conditions |
Maintained by natural mating. |
| Genotyping |
Primers: Forward: gaggtaaggaaggcctggtggatggag Reverse: ctgctctgcacccaagggtcactcac
PCR conditions: 95°C 2min, 95°C 30s, 58°C 30s, 72°C 1min, 30 cycles
WT 657 bp, KO 413 bp |
| References |
Nakano et al., Right ventricular overloading is attenuated in monocrotaline-induced pulmonary hypertension model rats with a disrupted Gpr143 gene, the gene that encodes the 3,4-L-dihydroxyphenyalanine (L-DOPA) receptor., J Pharmacol Sci., 2021 |
| Additional strain information |
|
|