| NBRP Rat No: 1034 |
Strain name: WIC;W-Oprk1em1(cre)Nurep |
Commmon Name: Oprk1-Cre |
Rat Genome Database |
| Principal Investigator: |
Yoshihisa Uenoyama Nagoya University Nagoya, Aichi 464-8601, Japan 464-8601 Nagoya Japan |
| Tel: 052-789-5870 Fax: 052-789-4072 |
Email: uenoyama@nagoya-u.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白 |
| Inbred Generations |
10 (WICとの交配回数は6) |
| Usage Restrictions |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) Designated by the DEPOSITOR is requested. Nagae M, Yamada K, Enomoto Y, Kometani M, Tsuchida H, Panthee A, Nonogaki M, Matsunaga N, Takizawa M, Matsuzaki S, Hirabayashi M, Inoue N, Tsukamura H, Uenoyama Y. Conditional Oprk1-dependent Kiss1 deletion in kisspeptin neurons caused estrogen-dependent LH pulse disruption and LH surge attenuation in female rats. Sci Rep 2023; 13(1):20495. The following specific terms and conditions are requested by the DEPOSITOR. In this event, the recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. If the RECIPIENT is a commercial organization or if the RECIPIENT wishes to use the BIOLOGICAL RESOURCE for commercial purposes, the RECIPINT shall reach an agreement with the DEPOSITOR on terms and conditions of use of BIOLOGICAL RESOURCE and shall obtain a prior written consent from the DEPOSITOR. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Oprk1 |
| Origin |
Oprk1-cre rats were generated by Dr. Hiroko Tsukamura, Dr. Yoshihisa Uenoyama, Dr. Naoko Inoue, Dr. Mayuko Nagae (Nagoya University) and Dr. Masumi Hirabayashi (National Institute for Physiological Sciences). The CRISPR/Cas9 and adeno-associated virus vector (Oprk1 [exon 4], T2A, Cre) were introduced into the pronuclear stage embryos of Wistar rats (Crlj:WI). It was maintained by mating with the Wistar-Imamichi rats (Iar:WIC) or by sibling mating. |
| Strain characteristics |
Cre recombinase is expressed specifically in Oprk1-expressing cells. |
| Breeding Conditions |
Both heterozygous and homozygous rats can be bred. |
| Genotyping |
PCR and electrophoresis. Wild type: 1082 bp, Mutant: 2187 bp, Primer (Final concentration 2 uM), F1 (#869): gatgtcattgaatgctccttgc, R1 (#1496): cccagtgtcagggtctgagt, KOD-Fx, 35 cycles, 94℃ 2 min, 98℃ 15 sec, 60℃ 30 sec, 68℃ 2 min, 68℃ 10 min, 4℃ |
| References |
Nagae M, Yamada K, Enomoto Y, Kometani M, Tsuchida H, Panthee A, Nonogaki M, Matsunaga N, Takizawa M, Matsuzaki S, Hirabayashi M, Inoue N, Tsukamura H, Uenoyama Y. Conditional Oprk1-dependent Kiss1 deletion in kisspeptin neurons caused estrogen-dependent LH pulse disruption and LH surge attenuation in female rats. Sci Rep 2023; 13(1):20495. |
| Additional strain information |
|
|
|