Strain information
 NBRP Rat No: 1034  Strain name: WIC;W-Oprk1em1(cre)Nurep  Commmon Name: Oprk1-Cre Rat Genome Database
Principal Investigator:  Yoshihisa Uenoyama  Nagoya University       Nagoya, Aichi 464-8601, Japan    464-8601 Nagoya     Japan
Tel: 052-789-5870    Fax: 052-789-4072 Email: uenoyama@nagoya-u.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  10 (WICとの交配回数は6)
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) Designated by the DEPOSITOR is requested.
Nagae M, Yamada K, Enomoto Y, Kometani M, Tsuchida H, Panthee A, Nonogaki M, Matsunaga N, Takizawa M, Matsuzaki S, Hirabayashi M, Inoue N, Tsukamura H, Uenoyama Y. Conditional Oprk1-dependent Kiss1 deletion in kisspeptin neurons caused estrogen-dependent LH pulse disruption and LH surge attenuation in female rats. Sci Rep 2023; 13(1):20495.
The following specific terms and conditions are requested by the DEPOSITOR. In this event, the recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
If the RECIPIENT is a commercial organization or if the RECIPIENT wishes to use the BIOLOGICAL RESOURCE for commercial purposes, the RECIPINT shall reach an agreement with the DEPOSITOR on terms and conditions of use of BIOLOGICAL RESOURCE and shall obtain a prior written consent from the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Oprk1
Origin Oprk1-cre rats were generated by Dr. Hiroko Tsukamura, Dr. Yoshihisa Uenoyama, Dr. Naoko Inoue, Dr. Mayuko Nagae (Nagoya University) and Dr. Masumi Hirabayashi (National Institute for Physiological Sciences). The CRISPR/Cas9 and adeno-associated virus vector (Oprk1 [exon 4], T2A, Cre) were introduced into the pronuclear stage embryos of Wistar rats (Crlj:WI). It was maintained by mating with the Wistar-Imamichi rats (Iar:WIC) or by sibling mating.
Strain characteristics Cre recombinase is expressed specifically in Oprk1-expressing cells.
Breeding Conditions Both heterozygous and homozygous rats can be bred.
Genotyping PCR and electrophoresis. Wild type: 1082 bp, Mutant: 2187 bp, Primer (Final concentration 2 uM), F1 (#869): gatgtcattgaatgctccttgc, R1 (#1496): cccagtgtcagggtctgagt, KOD-Fx, 35 cycles, 94℃ 2 min, 98℃ 15 sec, 60℃ 30 sec, 68℃ 2 min, 68℃ 10 min, 4℃
References Nagae M, Yamada K, Enomoto Y, Kometani M, Tsuchida H, Panthee A, Nonogaki M, Matsunaga N, Takizawa M, Matsuzaki S, Hirabayashi M, Inoue N, Tsukamura H, Uenoyama Y. Conditional Oprk1-dependent Kiss1 deletion in kisspeptin neurons caused estrogen-dependent LH pulse disruption and LH surge attenuation in female rats. Sci Rep 2023; 13(1):20495.
Additional strain information