Strain information
 NBRP Rat No: 0972  Strain name: ZFDM-Lcn2em1Nyo  Commmon Name: ZFDM Lcn2 Knock-in em1 Rat Genome Database
Principal Investigator:  Norihide Yokoi  Kobe University Graduate School of Medicine       Kobe BT Center, 1-5-6, Minatojima Minami-cho, Chuo-ku, Kobe    650-0047 Hyogo     Japan
Tel: 078-304-6046    Fax: 078-304-6057 Email: yokoi@med.kobe-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  black hooded(a,B,C,h)
Inbred Generations  
Usage Restrictions  Prior to requesting the BIOLOGICAL RESORCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Lcn2, Lipocalin 2 (Rattus norvegicus)
Origin This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA.
Strain characteristics Males homozygous for the Lepr mutation (fa/fa) develop obesity and diabetes, similar to males homozygous for the fa/fa ZFDM rat strain.
Breeding Conditions Breeding is performed by mating fa/+ heterozygous females at the Lepr locus with fa/fa homozygous males. Both males and females homozygous for the wild-type allele of Lcn2 had no fertility problems.
Genotyping The genotype of the Lcn2 mutation is determined using PCR-RFLP. PCR primers, rLcn2-F: aaccctgggtatgacctgaa; rLcn2-R: ctggggcctggattattgta, XspI digestion. The genotype of the Lepr mutation is determined using PCR-RFLP. PCR primers, rLepr-F: aagccatctcatttgctggt; rLepr-R: ggcaggcagatctctcaatc, MspI digestion.
References Yokoi N, Adachi N, Hirokoji T, Nakano K, Yoshihara M, Shigenaka S, Urakawa R, Taniguchi Y, Yoshida Y, Yokose S, Suyama M, Okamura T.
Comparative transcriptome and mutation analyses of the pancreatic islets of a rat model of obese type 2 diabetes identifies a frequently distributed nonsense mutation in the lipocalin 2 gene.
DNA Res. 2025 Mar 1;32(2):dsaf004.
Additional strain information