| NBRP Rat No: 0973 |
Strain name: ZFDM-Lcn2em2Nyo |
Commmon Name: ZFDM Lcn2 Knock-in em2 |
Rat Genome Database |
| Principal Investigator: |
Norihide Yokoi Kobe University Graduate School of Medicine Kobe BT Center, 1-5-6, Minatojima Minami-cho, Chuo-ku, Kobe 650-0047 Hyogo Japan |
| Tel: 078-304-6046 Fax: 078-304-6057 |
Email: yokoi@med.kobe-u.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
black hooded(a,B,C,h) |
| Inbred Generations |
F5 (2022.4.12) |
| Usage Restrictions |
Prior to requesting the BIOLOGICAL RESORCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Lcn2, Lipocalin 2 (Rattus norvegicus) |
| Origin |
This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA.
|
| Strain characteristics |
Males homozygous for the Lepr mutation (fa/fa) develop obesity and diabetes, similar to males homozygous for the fa/fa ZFDM rat strain. |
| Breeding Conditions |
Breeding is performed by mating fa/+ heterozygous females at the Lepr locus with fa/fa homozygous males. Both males and females homozygous for the wild-type allele of Lcn2 had no fertility problems. |
| Genotyping |
The genotype of the Lcn2 mutation is determined using PCR-RFLP. PCR primers, rLcn2-F: aaccctgggtatgacctgaa; rLcn2-R: ctggggcctggattattgta, XspI digestion. The genotype of the Lepr mutation is determined using PCR-RFLP. PCR primers, rLepr-F: aagccatctcatttgctggt; rLepr-R: ggcaggcagatctctcaatc, MspI digestion. |
| References |
Yokoi N, Adachi N, Hirokoji T, Nakano K, Yoshihara M, Shigenaka S, Urakawa R, Taniguchi Y, Yoshida Y, Yokose S, Suyama M, Okamura T.
Comparative transcriptome and mutation analyses of the pancreatic islets of a rat model of obese type 2 diabetes identifies a frequently distributed nonsense mutation in the lipocalin 2 gene.
DNA Res. 2025 Mar 1;32(2):dsaf004.
|
| Additional strain information |
|
|