NBRP Rat No: 1017 |
Strain name: LE.W-Tg(Dbh-tTA,-cre)2_7Fusa/Koba |
Commmon Name: DBH-Cre-BACTg2_7_917 |
Rat Genome Database |
Principal Investigator: |
Kazuto Kobayashi Fukushima Medical University 1 Hikarigaoka Fukushima-shi 960-1295 Fukushima Japan |
Tel: 024-547-1667 Fax: 024-548-3936 |
Email: kazuto@fmu.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
Coat Color |
白黒 |
Inbred Generations |
F10 (July 2023) |
Usage Restrictions |
The user requires a collaboration with the depositor. Consult with the depositor about details beforehand. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
DBH promoter, TetR, VP16 protein minimal“F”-type activation domain, 2A, Cre |
Origin |
Background strain: Long-Evans (Institute for Animal Reproduction) Transgenes: DBH (rat), TetR (Escherichia coli), VP16 protein minimal "F"-type activation domain (Herpes simplex virus), 2A (Thosea asigna virus), Cre (P1 phage), bGlobin polyA (rabbit), loxP (P1 phage) The W-Tg(Dbh-tTA-2A-cre)2_7Fusa strain was provided by Dr. Fusao Kato and Dr. Yukari Takahashi of the Jikei University School of Medicine, and backcrossed to Long-Evans. |
Strain characteristics |
Tetracycline-controlled transactivator (tTA), 2A peptide, and Cre recombinase are exogenously integrated downstream of the rat dopamine β-hydroxylase (DBH) promoter. By infecting these animals with a virus vector carrying the loxP sequence or mating with animals carrying the loxP sequence, recombination reaction by the Cre-loxP system can be induced specifically in DBH-positive noradrenergic and adrenergic neurons. |
Breeding Conditions |
Good reproductive performance. Heterozygotes carrying the transgene are bred with Long Evans wild-type rats to maintain the line. |
Genotyping |
The Cre sequence is recognized by PCR, and positive individuals are selected. Primer sequence Cre-F: GCAGAACCTGAAGATGTTCGCGAT, Cre-R: AGGTATCTCTGACCAGAGTCATCC Reaction solution: Milli Q up to 10 μl・10x Ex buffer 1 μl・dNTP 1 μl・Primer Cre-F (10 pmol/ul) 0.2 μl・Primer Cre-R (10 pmol/ul) 0.2 μl・DNA 0.5 μl・Ex Taq Hot start (TAKARA) 0.075 μl/Total 10 μl Program: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 1 min) x 35; 72°C, 7 min; 10°C, pause Product: Cre; 656 bp |
References |
|
Additional strain information |
|
|