Strain information
 NBRP Rat No: 0884  Strain name: F344-Aspaem34Kyo Hcn1em1Kyo  Commmon Name: Rat Genome Database
Principal Investigator:  Takashi Kuramoto  Tokyo University of Agriculture       1737 Funako, Atsugi,    243-0034 Kanagawa     Japan
Tel: 046-270-6583    Fax: 046-270-6585 Email: tk206782@nodai.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  アルビノ
Inbred Generations  F6
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Aspa：aspartoacylase, Hcn1： Hyperpolarization activated cyclic nucleotide gated potassium channel 1
Origin This double mutant rat was generated by crossbreeding two strains, F344-Aspaem34Kyo (#0806) and F344-Hcn1em1Kyo (#0821), which were generated by the TALEN method using F344/NSlc rats. For more information, please check each strain data.
Strain characteristics A 16-base deletion in exon 4 of Aspa and a 7-base deletion in exon 4 of Hcn1. Tremor develops at 3 weeks of age.
Breeding Conditions Aspa is maintained homozygously, and Hcn1 is maintained homozygously or heterozygously. Both homozygous mating is possible.
Genotyping Determined by PCR. PCR conditions: (94℃, 3 minutes) → (94℃, 30 seconds → 55℃, 1 minute → 72℃, 45 seconds) × 40 cycles → (72℃, 3 minutes, → 15℃, 30 minutes) [Aspa 16bp deletion mutation] Primers: rAspa-e3-KO-F: aagaaagatgttttcaattttgttca, rAspa-e3-KO-R: tctactgtgccagcaggaag, PRODUCT SIZE: wild 151bp, KO 135bp
References A Nishitani, H Nagayoshi, S Takenaka, M Asano, S Shimizu, Y Ohno, T Kuramoto
Involvement of NMDA receptors in tremor expression in Aspa/Hcn1 double-knockout rats
Exp Anim. 2020 Nov 12;69(4):388-394.

Nishitani A, Tanaka M, Shimizu S, Kunisawa N, Yokoe M, Yoshida Y, Suzuki T, Sakuma T, Yamamoto T, Kuwamura M, Takenaka S, Ohono Y, Kuramoto T.
Involvement of aspartoacylase in tremor expression in rats.
Exp Anim. 2016; 65(3): 293-301.
Additional strain information