| NBRP Rat No: 1054 |
Strain name: LIS-ROSA26em1(tetO-H2BC11/tdTomato)Mabe |
Commmon Name: |
|
| Principal Investigator: |
Manabu Abe Niigata University 1-757 Asahimachidori, Chuo-Ku, Niigata 951-8585 Niigata Japan |
| Tel: 025-227-0621 Fax: 025-227-0816 |
Email: manabu@bri.niigata-u.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
 |
 |
| Coat Color |
頭巾班 |
| Inbred Generations |
F5 |
| Usage Restrictions |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature designated by the DEPOSITOR is requested. M. Abe et al., A novel technique for large-fragment knock-in animal production without ex vivo handling of zygotes. Sci Rep 13, 2245(2023)
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgement to the DEPOSITOR is requested. The following specific terms and conditions are requested by the DEPOSITOR. In this event, the recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. If a patent application is field as a result of research using resource, prior consent must be obtained from the depositor (or a notice to that effect must be field). For commercial use, a separate agreement with the depositor must be concluded in addition to this consent form.
|
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
ROSA26 |
| Origin |
This strain was generated by genome editing at Brain Research Institute, Niigata University by selecting rats in which the tetO-H2B_tdTomato sequence was inserted into the ROSA26 locus of Lister Hooded rats (NBRP-Rat No. 0873 Seac:Lister Hooded) by AAV-GONAD method. |
| Strain characteristics |
Tetracycline transactivator (tTA) activity-dependent expression of nuclear-localized red fluorescent protein (H2B_tdTomato) is expected in all cells, but this has not been experimentally demonstrated. |
| Breeding Conditions |
Both homozygous and heterozygous mutations of both sexes are possible for breeding. |
| Genotyping |
Genotyping can be determined by PCR
Bands (0.7 kbp, 0.8 kbp) can be confirmed by PCR using two types of primers.
Set 1 (knock-in): Band size 656 bp
rR26_0.5k scrF: GCTCTCGGGGCTCAGAAAAC
T3G(NT)-R: CCAGCTTACTTACCATGTCAGATC
Set 2 (knock-in): Band size 758 bp
bGpA-F1: AGAAAAGCCTTGACTTGAGG
rR26_0.5k scrR: GCTACAGCCTCGATTTGTGG
When detecting knock-in genes, use either primer set 1 or set 2 by PCR.
Wild-type genes can be detected with set 3 below.
Set 3 (wild type): band size 1127 bp
rR26_0.5k scrF: GCTCTCGGGGCTCAGAAAAC
rR26_0.5k scrR: GCTACAGCCTCGATTTGTGG
Perform PCR with Set 1 or 2 and Set 3. If both are positive, it is a heterozygous mutation.
If only one is positive, it is a homozygous mutation or wild type. |
| References |
M Abe, E Nakatsukasa, R Natsume, S Hamada, K Sakimura, A M Watabe, T Ohtsuka
A novel technique for large-fragment knock-in animal production without ex vivo handling of zygotes
Scientific Reports (2023 Feb 8) Vol. 13 Issue 1 Pages 2245 |
| Additional strain information |
|
|