Strain information
 NBRP Rat No: 1054  Strain name: LIS-ROSA26em1(tetO-H2BC11/tdTomato)Mabe  Commmon Name:
Principal Investigator:  Manabu Abe  Niigata University       1-757 Asahimachidori, Chuo-Ku, Niigata    951-8585 Niigata     Japan
Tel: 025-227-0621    Fax: 025-227-0816 Email: manabu@bri.niigata-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color   頭巾班
Inbred Generations  F5
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature designated by the DEPOSITOR is requested.
M. Abe et al., A novel technique for large-fragment knock-in animal production without ex vivo handling of zygotes. Sci Rep 13, 2245(2023)

In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgement to the DEPOSITOR is requested.
The following specific terms and conditions are requested by the DEPOSITOR. In this event, the recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
If a patent application is field as a result of research using resource, prior consent must be obtained from the depositor (or a notice to that effect must be field).
For commercial use, a separate agreement with the depositor must be concluded in addition to this consent form.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected ROSA26
Origin This strain was generated by genome editing at Brain Research Institute, Niigata University by selecting rats in which the tetO-H2B_tdTomato sequence was inserted into the ROSA26 locus of Lister Hooded rats (NBRP-Rat No. 0873 Seac:Lister Hooded) by AAV-GONAD method.
Strain characteristics Tetracycline transactivator (tTA) activity-dependent expression of nuclear-localized red fluorescent protein (H2B_tdTomato) is expected in all cells, but this has not been experimentally demonstrated.
Breeding Conditions Both homozygous and heterozygous mutations of both sexes are possible for breeding.
Genotyping Genotyping can be determined by PCR Bands (0.7 kbp, 0.8 kbp) can be confirmed by PCR using two types of primers. Set 1 (knock-in): Band size 656 bp rR26_0.5k scrF: GCTCTCGGGGCTCAGAAAAC T3G(NT)-R: CCAGCTTACTTACCATGTCAGATC Set 2 (knock-in): Band size 758 bp bGpA-F1: AGAAAAGCCTTGACTTGAGG rR26_0.5k scrR: GCTACAGCCTCGATTTGTGG When detecting knock-in genes, use either primer set 1 or set 2 by PCR. Wild-type genes can be detected with set 3 below. Set 3 (wild type): band size 1127 bp rR26_0.5k scrF: GCTCTCGGGGCTCAGAAAAC rR26_0.5k scrR: GCTACAGCCTCGATTTGTGG Perform PCR with Set 1 or 2 and Set 3. If both are positive, it is a heterozygous mutation. If only one is positive, it is a homozygous mutation or wild type.
References M Abe, E Nakatsukasa, R Natsume, S Hamada, K Sakimura, A M Watabe, T Ohtsuka
A novel technique for large-fragment knock-in animal production without ex vivo handling of zygotes
Scientific Reports (2023 Feb 8) Vol. 13 Issue 1 Pages 2245
Additional strain information