Strain information
 NBRP Rat No: 1041  Strain name: WIC-Myod1em1(GFP)Kywf  Commmon Name: MyoD-GFP rat Rat Genome Database
Principal Investigator:  Keitaro Yamanouchi  The University of Tokyo        1-1-1, Yayoi, Bunkyo-ku,    113-8657 Tokyo     Japan
Tel: 03-5841-5386    Fax: 03-5841-8017 Email: akeita@g.ecc.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  F15
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 筋疾患
 Control Strain  Marker Strain
Gene Affected MyoD
Origin A rat strain expressing MyoD-GFP fusion protein by knocking the GFP gene into the 3′-terminal end of the rat MyoD gene (CRISPR/Cas9). Genetic background: Iar: Wistar-Imamichi (Institute for Animal Reproduction).
Strain characteristics No significant abnormalities are observed even after homogenization.
Breeding Conditions Maintained by between heterozygous, between homozygous, or homozygous/heterozygous mating.
Genotyping rMyoD_Fw, CAGCATAGTGGAGCGCATCTC rMyoD_Rv, AGCAGCAGCAACAACAACCAG The presence or absence of GFP insertion can be determined by PCR with genomic DNA using these primers.
References
Additional strain information