Strain information
 NBRP Rat No: 1042  Strain name: WIC-Myf5em1(mCherry)Kywf  Commmon Name: Myf5-mCherry rat
Principal Investigator:  Keitaro Yamanouchi  The University of Tokyo        1-1-1, Yayoi, Bunkyo-ku,    113-8657 Tokyo     Japan
Tel: 03-5841-5386    Fax: 03-5841-8017 Email: akeita@g.ecc.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 筋疾患
 Control Strain  Marker Strain
Gene Affected Myf5
Origin A rat strain expressing Myf5-mCherry fusion protein by knocking the mCherry gene into the 3′end of the rat Myf5 gene (CRISPR/Cas9). Genetic background: Iar: Wistar-Imamichi (Institutefor Animal Reproduction).
Strain characteristics No significant abnormalities are observed even after homogenization.
Breeding Conditions Maintained by between heterozygous, between homozygous, or homozygous/heterozygous mating.
Genotyping rMyf5_Fw, AGCCTGTCTGTGTGGGGACAG rMyf5_Rv, GCAAAAAGAACAGGCAGAGGAG The presence or absence of mCherry insertion can be determined by PCR on genomic DNA using these primers.
References
Additional strain information