Strain information
 NBRP Rat No: 1048  Strain name: LE-Pvalbem2(flpo)Koba  Commmon Name: PV-Flpo-2
Principal Investigator:  Kazuto Kobayashi  Fukushima Medical University       1 Hikarigaoka Fukushima-shi    960-1295 Fukushima     Japan
Tel: 024-547-1667    Fax: 024-548-3936 Email: kazuto@fmu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  白黒
Inbred Generations   F7 (March 2025)
Usage Restrictions  The user requires a collaboration with the depositor. Consult with the depositor about details beforehand.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Pvalb (parvalbumin)
Origin Background strain: Long-Evans (Iar:Long-Evans, Institute for Animal Reproduction). Using the CRISPR/Cas9 system (Combi-CRISPR), the "T2A-Flpo" sequence was inserted into the stop codon within the fourth exon of the parvalbumin (Pvalb) gene in fertilized rat eggs. In the PVA-Flpo-2 strain, a two-base deletion and a single-base substitution (underline) were observed in the third intron of the Pvalb gene due to NHEJ after a double-strand break induced by Combi-CRISPR. Target site sequence: Wild type: TTGGCGGGCCAGAACCTCAG(GGG) Knock-in strain: TTGGCAGGCCAGAACーーCAG(GGG)                       (  ) indicates the PAM sequence.
Strain characteristics Flpo is expressed in accordance with the spatiotemporal expression of Pvalb.
Breeding Conditions Good breeding performance. Maintained by mating heterozygous rats with Long-Evans rats.
Genotyping Forward primer: 5'-GTGCATTTCCAGAGGTGACAG (within the third intron) Reverse primer: 5'-GGTGGTGTCCGATGGGTACAG (within the 3'UTR) Amplified fragment size: Wild-type: 421 bp; Knock-in: 1778 bp In heterozygotes, both wild-type and knock-in amplifications were detected simultaneously.
References 準備中
Additional strain information