Strain information
 NBRP Rat No: 1049  Strain name: LE-Tg(Chat-IL2RA/YFP*)43Koba  Commmon Name: ChAT-IL-2Ra-43
Principal Investigator:  Kazuto Kobayashi  Fukushima Medical University       1 Hikarigaoka Fukushima-shi    960-1295 Fukushima     Japan
Tel: 024-547-1667    Fax: 024-548-3936 Email: kazuto@fmu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  白黒
Inbred Generations  F21
Usage Restrictions  The user requires a collaboration with the depositor. Consult with the depositor about details beforehand.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected IL2R: alpha-subunit, ChAT: choline acetyltransferase
Origin Background strain: Long-Evans (Iar:Long-Evans, Institute for Animal Reproduction). This rat strain was generated by injecting a modified BAC, in which a fusion protein made from the IL2R alpha-subunit gene and YFP was inserted into the start codon of the rat ChAT gene, into fertilized eggs of Long-Evans rats.
Strain characteristics Transgenic rats expressing a fusion protein made from the IL2R alpha-subunit gene and YFP under the control of ChAT.
Breeding Conditions Good breeding performance. Maintained by mating heterozygous rats with Long-Evans rats.
Genotyping Positive individuals are selected by recognizing the IL2RA sequence by PCR . Primer sequence: F: ATGGATTCATACCTGCTGAT R: GCTACCTGGTACTCTGTTGT PCR conditions: Enzyme: TaKaRa Taq 94℃ 5 min → 94℃ (30 cycles) 20 sec → 56℃ 30 sec → 72℃ 30 sec → 4℃ infinity Amplified fragment size: 724 bp
References Okada, K. et al. Enhanced flexibility of place discrimination learning by targeting of striatal cholinergic interneurons. Nat. Commun. 5: 3778 (2014).
Additional strain information