Strain information
 NBRP Rat No: 1050  Strain name: LE-Tg(Tac1-IL2RA/YFP*)2-6Koba  Commmon Name: Tac1-IL-2Ra-mVenus RecBAC2-6
Principal Investigator:  Kazuto Kobayashi  Fukushima Medical University       1 Hikarigaoka Fukushima-shi    960-1295 Fukushima     Japan
Tel: 024-547-1667    Fax: 024-548-3936 Email: kazuto@fmu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  白黒
Inbred Generations   F16 (March 2025)
Usage Restrictions  The user requires a collaboration with the depositor. Consult with the depositor about details beforehand.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected IL2R: alpha-subunit, Tac1: preprotachykinin-A
Origin Background strain: Long-Evans (Iar:Long-Evans, Institute for Animal Reproduction). This rat strain was generated by injecting a modified BAC, in which a fusion protein made from the IL2R alpha-subunit gene and YFP was inserted into the second exon of the rat Tac1 gene, into fertilized eggs of Long-Evans rats.
Strain characteristics A transgenic rat expressing a fusion protein constructed from the IL2RA alpha-subunit gene and YFP under the control of Tac1.
Breeding Conditions Good breeding performance. Maintained by mating heterozygous rats with Long-Evans rats.
Genotyping "Positive individuals were selected by recognizing the IL2RA sequence by PCR. Primer sequence: F: ATGGATTCATACCTGCTGAT R: GCTACCTGGTACTCTGTTGT PCR conditions: Enzyme: TaKaRa Taq 94℃ 5 min → 94℃(30 cycles) 20 sec → 56℃ 30 sec → 72℃ 30 sec → 4℃ infinity Amplified fragment size: 724 bp"
References 準備中
Additional strain information