Strain information
 NBRP Rat No: 1057  Strain name: Jcl:WIST-Tg  Commmon Name: Wistar Hannover GALAS
Principal Investigator:  Akira Sato  The Institute of Environmental Toxicology           303-0043      Japan
Tel: 0297-27-4537    Fax: 0297-27-4519 Email: a.satoh@iet.or.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  albino
Inbred Generations  F0
Usage Restrictions  In publishing, a citation of the following literature designated by the DEPOSITOR is requested.　
Sato A, Abe K, Yuzuriha M, Fuji S, Takahashi N, Hojo H, Teramoto S, Aoyama H.
A novel mutation in the thyroglobulin gene that causes goiter and dwarfism in Wistar Hannover GALAS rats.
Mutat Res Fundam Mol Mutagen. 762:17-23, 2014.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other outbred
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Thyroglobulin (Tg) c.749－1G>T
Origin In the early 2000s, the BrlHan:WIST@Jcl(GALAS) rat population contained individuals carrying the Tgc.749-1G>T mutation at a relatively high frequency. The animals to be deposited are individuals that are heterozygous for the Tgc.749-1G>T mutation, selected among the rats generated by recovering fertilized eggs that had been collected and cryopreserved at that time.
Strain characteristics This mutant has the same mutation as DWH/Iet (NBRP Rat No: 0777). Homozygous individuals for this mutation exhibit a dwarf phenotype due to thyroid hormone deficiency. Heterozygous individuals develop goiter despite normal external appearance.
Breeding Conditions Good breeding performance.
Genotyping 1. Allele-specific PCR Wild-type: Forward, CCCTGAAATGCTATCTACATTTGTTTCG Mutant: Forward, CCCTGAAATGCTATCTACATTTGTTTCT Common: Reverse, CGGAATCTGCCAGAGATGAC 2. Direct sequencing including the mutation site Forward, CAGGCTGCTTTTGTAGATTT Reverse, CGGAATCTGCCAGAGATGAC
References Sato A, Abe K, Yuzuriha M, Fujii S, Takahashi N, Hojo H, Teramoto S, Aoyama H.
A novel mutation in the thyroglobulin gene that causes goiter and dwarfism in Wistar Hannover GALAS rats.
Mutat Res Fundam Mol Mech Mutagen. 762:17-23, 2014.
Additional strain information