Strain information
 NBRP Rat No: 1059  Strain name: WKY.Cg-Col17a1bl/Iet  Commmon Name: BL
Principal Investigator:  Akira Sato  The Institute of Environmental Toxicology           303-0043      Japan
Tel: 0297-27-4537    Fax: 0297-27-4519 Email: a.satoh@iet.or.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  albino
Inbred Generations  N8
Usage Restrictions  In publishing, a citation of the following literature designated by the DEPOSITOR is requested. 
Kato Y et al, Junctional epidermolysis bullosa in Sprague Dawley rats caused by a frameshift mutation of Col17a1 gene. Lab Invest. 2024;104(10):102132.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected bl (blister)
Origin This mutant was developed from a pair of Crl:CD[SD] rats. A male founder Crl:CD[SD] rat was mated with a female BrlHan:WIST@Jcl[GALAS] rat, and the resulting heterozygous carrier was backcrossed to WKY/NCrlCrlj. Backcrossing to WKY/NCrlCrlj was then continued for eight generations.
Strain characteristics This is an autosomal recessive mutation. The responsible mutation is a single-nucleotide duplication (c.932dup) in the Col17a1 gene. Homozygous individuals develop epidermolysis bullosa between days 0 and 1 after birth and die by day 2 after birth. Immunohistochemical staining of the skin basement membrane of homozygous individuals does not reveal type XVII collagen expression. Transmission electron microscopy reveals morphologically immature hemidesmosomes with lost inner plaques. This is a model rat of junctional bullous disease.
Breeding Conditions Maintained by backcrossing heterozygous famels or males to WKY/NCrlCrlj.
Genotyping 1. Allele-specific PCR Wild-type: Forward, CAGCATATGGTGTGAAGAAATGC Mutant: Forward, CAGCATATGGTGTGAAGAAATGA Common: Reverse, AGGACACCATGTGTTCTACCAG 2. Direct sequencing including the mutation site Forward, GCATGGCGGTGTTCAGTTCC Reverse, GCACGGATTCTCGCCTCTCT
References Kato Y et al, Junctional epidermolysis bullosa in Sprague Dawley rats caused by a frameshift mutation of Col17a1 gene. Lab Invest. 2024;104(10):102132.
Additional strain information