Strain information
 NBRP Rat No: 1046  Strain name: LE-Adora2aem2(flpo)Koba  Commmon Name: A2AR-Flpo-2
Principal Investigator:  Kazuto Kobayashi  Fukushima Medical University       1 Hikarigaoka Fukushima-shi    960-1295 Fukushima     Japan
Tel: 024-547-1667    Fax: 024-548-3936 Email: kazuto@fmu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  白黒
Inbred Generations   F9 (Nov. 2025)
Usage Restrictions  The user requires a collaboration with the depositor. Consult with the depositor about details beforehand.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Adora2a (adenosine A2a receptor)
Origin Background strain: Long-Evans (Iar:Long-Evans, Institute for Animal Reproduction). Using the CRISPR/Cas9 system (Combi-CRISPR), a double-strand break was targeted to the sequence near the stop codon in the third exon of the adenosine A2a receptor (Adora2a) gene locus in fertilized rat eggs, and a modified Flp recombinase gene (Flpo) was knocked in via homologous recombination. Therefore, Flpo expression is synchronized with the spatiotemporal regulation of Adora2a expression. In the A2AR-Flpo-2 line, a 40-base insertion (underline) is observed in the 3'UTR of the Adora2a gene due to NHEJ after a double-strand break induced by Combi-CRISPR. Target site sequence: TGCTTCTGCTTCGTGCTACG(GGG) A2AR-Flpo-2 knock-in line: TGCTTCTGCTTCGTGCTCCCACTTTGAACTACAAAGAAGTTCCCACTTTGAACTACTACG(GGG)                      (  ) indicates the PAM sequence.
Strain characteristics Flpo is expressed in accordance with the spatiotemporal regulation of Adora2a expression.
Breeding Conditions Good breeding performance. Maintained by mating heterozygous rats with Long-Evans rats.
Genotyping Forward primer: 5'-CACTGAGGGAGAGCAGGTTAGC (within exon 3) Reverse primer: 5'-AGCTCCTATATTCTAGCATCGG (within 3'UTR) Amplified fragment size: Wild-type: 591 bp; Knock-in: 1990 bp In heterozygotes, both wild-type and knock-in amplifications are detected simultaneously. An annealing temperature of 60℃ (or higher) is recommended.
References 準備中
Additional strain information