Strain information  NBRP Rat No: 1091  Strain name: W-Ccl12em1Larc  Commmon Name: W-Ccl12KO Principal Investigator:  Takeshi Ohkawara  Mie University, Graduate School of Medicine       2-174 Edobashi, Tsu city    514-8507 Mie     Japan Tel: 059-232-1111    Fax: 059-232-8031 Email: tohkawara@med.mie-u.ac.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color   Inbred Generations  5 Usage Restrictions   Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others   Control Strain  Marker Strain Gene Affected Ccl12 Origin This strain was generated at the Institute of Medical Science, The University of Tokyo, using the CRISPR-Cas9 system. The genome editing components were microinjected into fertilized eggs of Jcl:Wistar rats, which were then transferred into the oviducts of pseudopregnant females. This strain was generated by selecting offspring confirmed to have a deletion in the exon of the Ccl12 gene. Strain characteristics Under Analysis Breeding Conditions The strain is maintained by crossing heterozygotes with wild-type rats. Genotyping Genotypes can be detected by PCR and electrophoresis. KOD One PCR Master Mix (TOYOBO) 7.5 µl 10 µM Ccl12_gF 0.3 µl 10 µM Ccl12_gR 0.3 µl dH2O 6.4 µl ｇDNA 0.5 µl 98℃ 10 sec 60℃ 5 sec 30 cycles 68℃ 1 sec Electrophoresis on a 2% agarose gel WT alelle 1000 bp, mutant alelle 297 bp Ccl12_gF: atcctaccaggctccttgc Ccl12_gR: ccagactcctgtcacttgct References Additional strain information