Strain information
 NBRP Rat No: 1070  Strain name: WIC-Gpr75em1Nurep  Commmon Name: Gpr75 KOラット (#3)
Principal Investigator:  Yoshihisa Uenoyama  Nagoya University       Nagoya, Aichi 464-8601, Japan    464-8601 Nagoya     Japan
Tel: 052-789-5870    Fax: 052-789-4072 Email: uenoyama@nagoya-u.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  Albino
Inbred Generations  22
Usage Restrictions  In publishing, a citation of the following literature designated by the DEPOSITOR is requested. 
Otsuka et al. GPR75 signaling is dispensable for reproduction but contributes to feeding and body growth in rats on normal chow and is involved in high-fat diet-induced hyperphagia, obesity, and hyperglycemia development. Endor J. 2025. Doi:10.1507/endocrj. EJ25-0099

If the RECIPIENT is a commercial organization or if the RECIPIET wishes to use BIOLOGICAL RESOURCE for commercial purposes, the RECIPIET shall reach an agreement with the DEPOSITOR on terms and conditions of use of BIOLOGICAL RESOURCE and shall obtain a prior written consent from the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Gpr75
Origin To generate Gpr75 knockout rats, Hiroko Tsukamura and Yoshihisa Uenoyama (Nagoya University), Masumi Hirabayashi (National Institute for Physiological Sciences), and their colleagues created this strain. Two types of gRNAs targeting the Gpr75 locus and a Cas9-expressing vector were microinjected into pronuclear embryos (derived from Iar:Wistar-Imamichi rats). These rats were then crossed with Iar:Wistar-Imamichi rats and maintained.
Strain characteristics This is a nonsense mutant with an approximately 200 bp deletion in the Gpr75 gene, which introduces a premature stop codon via a frameshift. One of 3 strains.
Breeding Conditions Both heterozygous and homozygous Gpr75 mutants are fertile.
Genotyping Genotypes can be identified by PCR and electrophoresis. Wild-type: 638 bp, Mutant (#3): 411 bp Primers (final concentration: 2 µM): F1 (#1347): cctgcagggaggaaataaca R1 (#1348): cattcttccgaagggtttga KOD-Fx、95℃ 2 min、40 cycles (98℃ 20 sec, 60℃ 30 sec, 68℃ 30 sec)、 68℃ 10 min、4℃
References Otsuka Y, Inoue N, Hazim S, Seki S, Tsuchida H, Nagae M, Sugimoto Y, Kasugai D, Yogo K, Nakanishi M, Ieda N, Goto T, Hirabayashi M, Tsukamura H, Uenoyama Y.
GPR75 signaling is dispensable for reproduction but contributes to feeding and body growth in rats on normal chow and is involved in high-fat diet-induced hyperphagia, obesity, and hyperglycemia development.
Endocr J, in press.2025 Dec 1;72(12):1339-1355. doi: 10.1507/endocrj.EJ25-0099.
Additional strain information