NBRP Rat No: 0272 |
Strain name: F344-Tg(XPO1)1Hik |
Commmon Name: F344/DuCrj-Tg(XPO1)1Hik, F344/DuCrj-Tg(hCRM1)1Hik, F344/hcrm1 |
Rat Genome Database |
Principal Investigator: |
Hisatoshi Shida Hokkaido University Kita 15 Nishi 7, Kita-ku, Sapporo 060-0815 Hokkaido Japan |
Tel: 011-706-7543 Fax: 011-706-7543 |
Email: hmyy2010@yahoo.co.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
albino (c) |
Inbred Generations |
N5 |
Usage Restrictions |
Use of BIOLOGICAL RESOURCE shall be limited to a collaborative research with the DEPOSITOR. This condition is NOT limited to two-year period after deposition. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
XPO1: Exportin 1 (also known as chromosomal maintenance 1 (CRM1)) |
Origin |
F344/DuCrj Tg rat inoculated with human crm1 genome (BAC) |
Strain characteristics |
human CRM1 (XPO1) is ubiquitously expressed. |
Breeding Conditions |
Normal growing. Although homozygous female Tg rats are fertile, homozygous male Tg rats are infertile. A Study is ongoing to explore the reason. |
Genotyping |
Primer(TGAGGTCAGGAGTTCAGGAT, CTCTGCCTCCTGGGTTCAA), PCR cindition(annealing :69C, extension 15sec, 40 cycle), product size:~150 bp |
References |
Hiroyuki Okada, Xianfeng Zhang, Ismael B Fofana, Mika Nagai, Hajime Suzuki, Takashi Ohashi and Hisatoshi Shida (2009): Synergistic effect of human CycT1 and CRM1 on HIV-1 propagation in rat T cells and macrophages. Retrovirology 6:43
Ryo Takayanagi, Takashi Ohashi, Eizaburo Yamashita , Yohei Kurosaki, Kumiko Tanaka, Yoshiyuki Hakata, Yasumasa Komoda, Satoru Ikeda, Yasuko Tsunetsugu-Yokota, Yuetsu Tanaka, Hisatoshi Shida (2007): Enhanced Replication of Human T-cell Leukemia Virus Type 1 in T Cells from Transgenic Rats Expressing Human CRM1 That Is Regulated in a Natural Manner. J. Virol. 81: 5908-5918
|
Additional strain information |
F344 |
|