NBRP Rat No: 0442 |
Strain name: F344-Tg(CD4)1Hik |
Commmon Name: F344/DuCrlCrlj-Tg(CD4)1Hik, F344/DuCrlCrlj-Tg(hCD4)1Hik, F344-hCD4 |
Rat Genome Database |
Principal Investigator: |
Hisatoshi Shida Hokkaido University Kita 15 Nishi 7, Kita-ku, Sapporo 060-0815 Hokkaido Japan |
Tel: 011-706-7543 Fax: 011-706-7543 |
Email: hmyy2010@yahoo.co.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
albino (c) |
Inbred Generations |
2 |
Usage Restrictions |
Use of BIOLOGICAL RESOURCE shall be limited to a collaborative research with the DEPOSITOR, this condition is not limited to two-year period of the deposition. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
CD4 |
Origin |
A plasmid carrying the genomic region of the human CD4 was introduced to F344/DuCrj. (Nov 5, 2009) |
Strain characteristics |
Normal phenotype. |
Breeding Conditions |
normal breeding |
Genotyping |
hCD4: Primer(CCTAAGCTGATGCTGAGCTTGAAA, GTCCTTACCCTTGATGTTGGATT), PCR condition(annealing:57C, extension:30sec, 40 cycles), product size: ~150 bp |
References |
|
Additional strain information |
|
|