The National BioResource Project for the Rat in Japan

Strain information

Back to the list 380 / 882
NBRP Rat No: 0442
Strain name: F344-Tg(CD4)1Hik
Commmon Name: F344/DuCrlCrlj-Tg(CD4)1Hik, F344/DuCrlCrlj-Tg(hCD4)1Hik, F344-hCD4
Rat Genome Database
Principal Investigator:
Hisatoshi ShidaHokkaido University
Preservation Status:
Coat Color
albino (c)
Inbred Generations
2
Usage Restrictions
Use of BIOLOGICAL RESOURCE shall be limited to a collaborative research with the DEPOSITOR, this condition is not limited to two-year period of the deposition.
Genetic Status
Comercial Availability
Research Category
Gene Affected
CD4
Origin
A plasmid carrying the genomic region of the human CD4 was introduced to F344/DuCrj. (Nov 5, 2009)
Strain characteristics
Normal phenotype.
Breeding Conditions
normal breeding
Genotyping
hCD4: Primer(CCTAAGCTGATGCTGAGCTTGAAA, GTCCTTACCCTTGATGTTGGATT), PCR condition（annealing：57C, extension：30sec, 40 cycles）, product size: ~150 bp
References
Additional strain information (Japanese only)