Strain information
 NBRP Rat No: 0442  Strain name: F344-Tg(CD4)1Hik  Commmon Name: F344/DuCrlCrlj-Tg(CD4)1Hik, F344/DuCrlCrlj-Tg(hCD4)1Hik, F344-hCD4 Rat Genome Database
Principal Investigator:  Hisatoshi Shida  Hokkaido University       Kita 15 Nishi 7, Kita-ku, Sapporo    060-0815 Hokkaido     Japan
Tel: 011-706-7543    Fax: 011-706-7543 Email: hmyy2010@yahoo.co.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino (c)
Inbred Generations  2
Usage Restrictions  Use of BIOLOGICAL RESOURCE shall be limited to a collaborative research with the DEPOSITOR, this condition is not limited to two-year period of the deposition.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected CD4
Origin A plasmid carrying the genomic region of the human CD4 was introduced to F344/DuCrj. (Nov 5, 2009)
Strain characteristics Normal phenotype.
Breeding Conditions normal breeding
Genotyping hCD4: Primer(CCTAAGCTGATGCTGAGCTTGAAA, GTCCTTACCCTTGATGTTGGATT), PCR condition(annealing:57C, extension:30sec, 40 cycles), product size: ~150 bp
References
Additional strain information