Strain information  NBRP Rat No: 0523  Strain name: F344-Tg(CD4,CCNT1)1Hik  Commmon Name: F344/DuCrlCrlj-Tg(CD4,CCNT1)1Hik, F344-F4Y Rat Genome Database Principal Investigator:  Hisatoshi Shida  Hokkaido University       Kita 15 Nishi 7, Kita-ku, Sapporo    060-0815 Hokkaido     Japan Tel: 011-706-7543    Fax: 011-706-7543 Email: hmyy2010@yahoo.co.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color  albino (c) Inbred Generations  F2 (08.3.24) Usage Restrictions  Use of BIOLOGICAL RESOURCE shall be limited to a collaborative research with the DEPOSITOR. This condition is not limited to two-year period of the deposition. Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others   Control Strain  Marker Strain Gene Affected CD4: CD4 molecule, CCNT1: cyclin T1 Origin A BAC carrying the genomic region of the human CD4 and the human cyclin T1 (CCNT1) was introduced to F344/DuCrj. (Nov 5, 2009) Strain characteristics Normal phenotype. Breeding Conditions normal breeding Genotyping hCD4: Primer(CCTAAGCTGATGCTGAGCTTGAAA, GTCCTTACCCTTGATGTTGGATT), PCR condition（annealing：57C, extension：30sec, 40 cycles）, product size: ~150 bp. hCCNT1:Primer(CCAGTATTGAATATGTACCCTAGGTTTGG, CAACACTGGAAGTTCTGGATAGGCC), 条件（annealing：58C,extension：1 min), product size:~1 Kb References Additional strain information