Strain information
 NBRP Rat No: 0567  Strain name: F344-Trdk/Kyo  Commmon Name: Tremor dominant Kyoto, Annin, アンニンラット Rat Genome Database
Principal Investigator:  Tomoji Mashimo  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai-Minatoku-Tokyoto    108-8639      Japan
Tel: 03-6409-2489    Fax:  Email: mashimo@ims.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino (c)
Inbred Generations  G1 (Apr 2009)
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Kcnn2: potassium calcium-activated channel subfamily N member 2
Origin Tremor dominant Kyoto (Trdk) is an autosomal dominant mutation that appeared in F344/NSlc rats mutagenized with N-ethyl-N-nitrosourea (ENU)(phenotype driven). This strain exhibited dominantly-inherited body tremor. (Kuramoto st al., 2017.)
Strain characteristics The rats exhibited a tremor that was especially evident around weaning but persisted throughout life. The tremors of F344-Trdk/+ rats were attenuated by drugs effective against essential tremor (ET) but not drugs used to treat Parkinson's disease-related tremor, indicating that the pharmacological phenotype of F344-Trdk/+ rats was similar to human ET. The Trdk mutation was identified as a missense substitution (c. 866 T>A, p. I289N) in Kcnn2 (Kuramoto st al., 2017.)
Breeding Conditions Maintained by mating between Trdk/+ and F344/NSlc rats. (Sep, 2017)
Genotyping PCR-RFLP method: Primers are rKcnn2-An-F (caatggagcagatgactgga) and rKcnn2-An-R (acagtccatgcggcaattat) (Annealing temperature: 55℃). Product size: 390 bp. After digestion with BsrDI, Trdk allele is cut into 119 and 271 bp bands, but wild-type allele is not digested with KpnI. (Sep, 2017)
References Kuramoto T, Yokoe M, Kunisawa N, Ohashi K, Miyake T, Higuchi Y, Yoshimi K, Mashimo T, Tanaka M, Kuwamura M, Kaneko S4, Shimizu S, Serikawa T, Ohno Y.
Tremor dominant Kyoto (Trdk) rats carry a missense mutation in the gene encoding the SK2 subunit of small-conductance Ca2+-activated K+ channel.
Brain Res. 2017. 1676: 38-45.
Additional strain information