| NBRP Rat No: 0567 |
Strain name: F344-Trdk/Kyo |
Commmon Name: Tremor dominant Kyoto, Annin, アンニンラット |
Rat Genome Database |
| Principal Investigator: |
Tomoji Mashimo The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai-Minatoku-Tokyoto 108-8639 Japan |
| Tel: 03-6409-2489 Fax: |
Email: mashimo@ims.u-tokyo.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
albino (c) |
| Inbred Generations |
G1 (Apr 2009) |
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Kcnn2: potassium calcium-activated channel subfamily N member 2 |
| Origin |
Tremor dominant Kyoto (Trdk) is an autosomal dominant mutation that appeared in F344/NSlc rats mutagenized with N-ethyl-N-nitrosourea (ENU)(phenotype driven). This strain exhibited dominantly-inherited body tremor. (Kuramoto st al., 2017.) |
| Strain characteristics |
The rats exhibited a tremor that was especially evident around weaning but persisted throughout life. The tremors of F344-Trdk/+ rats were attenuated by drugs effective against essential tremor (ET) but not drugs used to treat Parkinson's disease-related tremor, indicating that the pharmacological phenotype of F344-Trdk/+ rats was similar to human ET. The Trdk mutation was identified as a missense substitution (c. 866 T>A, p. I289N) in Kcnn2 (Kuramoto st al., 2017.) |
| Breeding Conditions |
Maintained by mating between Trdk/+ and F344/NSlc rats. (Sep, 2017) |
| Genotyping |
PCR-RFLP method: Primers are rKcnn2-An-F (caatggagcagatgactgga) and rKcnn2-An-R (acagtccatgcggcaattat) (Annealing temperature: 55℃). Product size: 390 bp. After digestion with BsrDI, Trdk allele is cut into 119 and 271 bp bands, but wild-type allele is not digested with KpnI. (Sep, 2017)
|
| References |
Kuramoto T, Yokoe M, Kunisawa N, Ohashi K, Miyake T, Higuchi Y, Yoshimi K, Mashimo T, Tanaka M, Kuwamura M, Kaneko S4, Shimizu S, Serikawa T, Ohno Y.
Tremor dominant Kyoto (Trdk) rats carry a missense mutation in the gene encoding the SK2 subunit of small-conductance Ca2+-activated K+ channel.
Brain Res. 2017. 1676: 38-45. |
| Additional strain information |
|
|