Strain information

Back to the list 484 / 882

NBRP Rat No: 0561

Strain name: ACI.F344-(D16Nkg112-D16Nkg27)/Nkg

Commmon Name:

Rat Genome Database

Principal Investigator:

Hitoshi NakagamaNational Cancer center

Preservation Status:

Embryo Sperm Living Animals

Coat Color

agouti

Inbred Generations

F3 (Mar 2009)

Usage Restrictions

In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.

Genetic Status

Inbred Segregating Congenic Consomic Recombinant Coisogenic Spont. Mutant Transgene Ind. Mutant Category Other

Comercial Availability

Research Category

Diabetes Obesity Neurobiology Ophthalmology Dentistry Cardio Hypertension Cancer Metabolism Otorhinology Immunology Infectious Osteosis Internal Organ Dermatology Reproduction Development Behavior Hematology Urology Pharmacology Research Area Others

Control Strain Marker Strain

Gene Affected

Origin

F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established by backcrossing ACI.F344-(D16Nkg9-D16Nkg27) onto ACI/N, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. (Jul 7, 2009)

Strain characteristics

Breeding Conditions

Genotyping

About D16Nkg27, please refer to http://www.ncc.go.jp/jp/nccri/divisions/02bioc/02bioc01_3.html. About D16Nkg112, the product size is 244bp, forward primer: TGCCTTCTTAACTCTGACGG, reverse primer: GTTAGCCTGCCTCCATTTTT.

References

Additional strain information (Japanese only)