Strain information  NBRP Rat No: 0561  Strain name: ACI.F344-(D16Nkg112-D16Nkg27)/Nkg  Commmon Name: Rat Genome Database Principal Investigator:  Hitoshi Nakagama  National Cancer center        5-1-1 Tsukiji, Chuo-ku    104-0045 Tokyo     Japan Tel: 03-3542-2511    Fax: 03-3542-2530 Email: hnakagam@ncc.go.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color  agouti Inbred Generations  F3 (Mar 2009) Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others   Control Strain  Marker Strain Gene Affected Origin F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established by backcrossing ACI.F344-(D16Nkg9-D16Nkg27) onto ACI/N, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. (Jul 7, 2009) Strain characteristics Breeding Conditions Genotyping About D16Nkg27, please refer to http://www.ncc.go.jp/jp/nccri/divisions/02bioc/02bioc01_3.html. About D16Nkg112, the product size is 244bp, forward primer: TGCCTTCTTAACTCTGACGG, reverse primer: GTTAGCCTGCCTCCATTTTT. References Additional strain information