Strain information
 NBRP Rat No: 0561  Strain name: ACI.F344-(D16Nkg112-D16Nkg27)/Nkg  Commmon Name: Rat Genome Database
Principal Investigator:  Hitoshi Nakagama  National Cancer center        5-1-1 Tsukiji, Chuo-ku    104-0045 Tokyo     Japan
Tel: 03-3542-2511    Fax: 03-3542-2530 Email: hnakagam@ncc.go.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  agouti
Inbred Generations  F3 (Mar 2009)
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected
Origin F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established by backcrossing ACI.F344-(D16Nkg9-D16Nkg27) onto ACI/N, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. (Jul 7, 2009)
Strain characteristics
Breeding Conditions
Genotyping About D16Nkg27, please refer to http://www.ncc.go.jp/jp/nccri/divisions/02bioc/02bioc01_3.html. About D16Nkg112, the product size is 244bp, forward primer: TGCCTTCTTAACTCTGACGG, reverse primer: GTTAGCCTGCCTCCATTTTT.
References
Additional strain information