| NBRP Rat No: 0569 |
Strain name: SD-Tg(CAG-lacZ)541Htsu |
Commmon Name: SD-Tg(CALNL-LacZ)541, LacZ541 |
Rat Genome Database |
| Principal Investigator: |
Hiroyuki Tsuda Nagoya City University Graduate School of Medical Sciences 1 Kawasumi, Mizuho-cho Mizuho-ku, Nagoya 467-8601 Aichi Japan |
| Tel: 052-853-8992 Fax: 052-853-8996 |
Email: htsuda@med.nagoya-cu.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
albino (c) |
| Inbred Generations |
|
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain prior written consent concerning usage from the DEPOSITOR. The recipient must agree on collaborative research with the DEPOSITOR until publication of literature. This condition is not limited to a two-year period after deposition. After publication, the recipient is requested to cite the literature designated by the DEPOSITOR. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
lacZ: beta-galactosidase, E. coli |
| Origin |
This transgenic rat was originated from SD strain. (Oct 30, 2009) LacZ gene expression is controlled by Cre-loxP system. |
| Strain characteristics |
The transgene is regulated by the Cre/loxP system. LacZ is driven by CAG promoter. (Oct 30, 2009) |
| Breeding Conditions |
Maintained in homozygous condition. (Oct 30, 2009) |
| Genotyping |
primers: 5'- TCTGGATCAAATCCGAACGC -3' and 5'- TCCTGTAGCCAGCTTTCATC -3’,
product size: bp
|
| References |
Fukamachi K, Tanaka H, Sakai Y, Alexander DB, Futakuchi M, Tsuda H, Suzui M.
A novel reporter rat strain that expresses LacZ upon Cre-mediated recombination.
Genesis.2013 ;51(4):268-74
|
| Additional strain information |
|
|