Strain information
 NBRP Rat No: 0569  Strain name: SD-Tg(CAG-lacZ)541Htsu  Commmon Name: SD-Tg(CALNL-LacZ)541, LacZ541 Rat Genome Database
Principal Investigator:  Hiroyuki Tsuda   Nagoya City University Graduate School of Medical Sciences       1 Kawasumi, Mizuho-cho Mizuho-ku, Nagoya    467-8601 Aichi     Japan
Tel: 052-853-8992    Fax: 052-853-8996 Email: htsuda@med.nagoya-cu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino (c)
Inbred Generations  
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain prior written consent concerning usage from the DEPOSITOR. The recipient must agree on collaborative research with the DEPOSITOR until publication of literature. This condition is not limited to a two-year period after deposition. After publication, the recipient is requested to cite the literature designated by the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others レポーター遺伝子動物
 Control Strain  Marker Strain
Gene Affected lacZ: beta-galactosidase, E. coli
Origin This transgenic rat was originated from SD strain. (Oct 30, 2009) LacZ gene expression is controlled by Cre-loxP system.
Strain characteristics The transgene is regulated by the Cre/loxP system. LacZ is driven by CAG promoter. (Oct 30, 2009)
Breeding Conditions Maintained in homozygous condition. (Oct 30, 2009)
Genotyping primers: 5'- TCTGGATCAAATCCGAACGC -3' and 5'- TCCTGTAGCCAGCTTTCATC -3’, product size: bp
References Fukamachi K, Tanaka H, Sakai Y, Alexander DB, Futakuchi M, Tsuda H, Suzui M.
A novel reporter rat strain that expresses LacZ upon Cre-mediated recombination.
Genesis.2013 ;51(4):268-74
Additional strain information