Strain information
 NBRP Rat No: 0621  Strain name: F344-Tg(NC1-269B17)1Nkg  Commmon Name: Rat Genome Database
Principal Investigator:  Hitoshi Nakagama  National Cancer center        5-1-1 Tsukiji, Chuo-ku    104-0045 Tokyo     Japan
Tel: 03-3542-2511    Fax: 03-3542-2530 Email: hnakagam@ncc.go.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  albino (c)
Inbred Generations  N3 (Jun 4,2010)
Usage Restrictions   In publishing, an acknowledgment to the DEPOSITOR is requested.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected BAC clone: NC1-269B17, Casp3: caspase 3
Origin BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Caps3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. There are 4 lines which have different copy numbers (NBRP No.0621-0624). (Nov 11, 2010)
Strain characteristics This transgenic rat possesses one copy of BAC clone. Hemizygous rat expresses higher level of Casp3 protein in adenocarcinoma of the large intestine than that of wild type rat. This transgenic rat is lower susceptible to PhIP-induced ACF (aberrant crypt foci) formation than the wild-type rat. (Nov 11, 2010)
Breeding Conditions This strain is maintained by backcrossing of male transgenic rats into female F344/Jcl. (Nov 11, 2010)
Genotyping Genotyping by PCR-RFLP analysis. Forward Primer (gaccataataccagctgtcagtca), Reverse primer (cctctttgactctcccaaattaaa), annealing temp 54℃. The product size of Mbo I digestion is 199- and 640-bp for F344 and 54-, 145- and 640-bp for ACI. (Nov 11, 2010)
References
Additional strain information