| NBRP Rat No: 0623 |
Strain name: F344-Tg(NC1-269B17)3Nkg |
Commmon Name: |
Rat Genome Database |
| Principal Investigator: |
Hitoshi Nakagama National Cancer center 5-1-1 Tsukiji, Chuo-ku 104-0045 Tokyo Japan |
| Tel: 03-3542-2511 Fax: 03-3542-2530 |
Email: hnakagam@ncc.go.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
 |
|
| Coat Color |
albino (c) |
| Inbred Generations |
N3 (Jun 4,2010) |
| Usage Restrictions |
In publishing, an acknowledgment to the DEPOSITOR is requested. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
BAC clone: NC1-269B17, Casp3: caspase 3 |
| Origin |
BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Caps3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. There are 4 lines which have different copy numbers (NBRP No.0621-0624). (Nov 11, 2010) |
| Strain characteristics |
This transgenic rat possesses three copies of BAC clone. Hemizygous rat expresses higher level of Casp3 protein in adenocarcinoma of the large intestine than that of wild type rat. In crossing a male Tg rat with female F344/Jcl, males are all non-Tg and females are all Tg, suggesting that Tg was introduced onto chromosome X. (Nov 11, 2010) |
| Breeding Conditions |
This strain is maintained by backcrossing transgenic rats into F344/Jcl with attention to transgene which introduced onto chromosome X. (Nov 11, 2010) |
| Genotyping |
Genotyping by PCR-RFLP analysis. Forward Primer (gaccataataccagctgtcagtca), Reverse primer (cctctttgactctcccaaattaaa), annealing temp 54℃. The product size of Mbo I digestion is 199- and 640-bp for F344 and 54-, 145- and 640-bp for ACI. (Nov 11, 2010) |
| References |
|
| Additional strain information |
|
|