Strain information

Back to the list 538 / 882

NBRP Rat No: 0624

Strain name: F344-Tg(NC1-269B17)4Nkg

Commmon Name:

Rat Genome Database

Principal Investigator:

Hitoshi NakagamaNational Cancer center

Preservation Status:

Embryo Sperm Living Animals

Coat Color

albino (c)

Inbred Generations

N4 (Jun 4, 2010)

Usage Restrictions

In publishing, an acknowledgment to the DEPOSITOR is requested.

Genetic Status

Inbred Segregating Congenic Consomic Recombinant Coisogenic Spont. Mutant Transgene Ind. Mutant Category Other

Comercial Availability

Research Category

Diabetes Obesity Neurobiology Ophthalmology Dentistry Cardio Hypertension Cancer Metabolism Otorhinology Immunology Infectious Osteosis Internal Organ Dermatology Reproduction Development Behavior Hematology Urology Pharmacology Research Area Others

Control Strain Marker Strain

Gene Affected

BAC clone: NC1-269B17, Casp3: caspase 3

Origin

BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Caps3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. There are 4 lines which have different copy numbers (NBRP No.0621-0624). (Nov 11, 2010)

Strain characteristics

This transgenic rat possesses 30 copies of BAC clone. Hemizygous rat expresses higher level of Casp3 protein in adenocarcinoma of the large intestine than that of wild type rat. This transgenic rat is lower susceptible to PhIP-induced ACF (aberrant crypt foci) formation than the wild-type rat. (Nov 11, 2010)

Breeding Conditions

This strain is maintained by backcrossing of male transgenic rats into female F344/Jcl. (Nov 11, 2010)

Genotyping

Genotyping by PCR-RFLP analysis. Forward Primer (gaccataataccagctgtcagtca), Reverse primer (cctctttgactctcccaaattaaa), annealing temp 54℃. The product size of Mbo I digestion is 199- and 640-bp for F344 and 54-, 145- and 640-bp for ACI. (Nov 11, 2010)

References

Additional strain information (Japanese only)