Strain information
 NBRP Rat No: 0585  Strain name: F344-Il2rgem1Kyo  Commmon Name: X-SCID Rat Genome Database
Principal Investigator:  Tomoji Mashimo  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai-Minatoku-Tokyoto    108-8639      Japan
Tel: 03-6409-2489    Fax:  Email: mashimo@ims.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino (c)
Inbred Generations  N3
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The recipient must obey regulations stipulated in the liscence agreement of Sigma-Aldrich Co. LLC.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected interleukin 2 receptor gamma (Il2rg)
Origin This strain is established by ZFN method targeting rat Il2rg gene. Background strain: F344/Stm
Strain characteristics This strain shows severe combined immunodeficiency caused by a 660 bp deletion in Il2rg gene and grow normally under SPF condition.
Breeding Conditions maintained by mating between hemizygous male and homozygous female
Genotyping Genotyping by PCR analysis. wild:1509-bp, mutant:849-bp primers:TCTCCCAGGGGACTTAGCTTA, TGGGACCTGGTGTTAGGTTT
References Takeishi K, Collin de l'Hortet A, Wang Y, Handa K, Guzman-Lepe J, Matsubara K, Morita K, Jang S, Haep N, Florentino RM, Yuan F, Fukumitsu K, Tobita K, Sun W, Franks J, Delgado ER, Shapiro EM, Fraunhoffer NA, Duncan AW, Yagi H, Mashimo T, Fox IJ, Soto-Gutierrez A.
Assembly and Function of a Bioengineered Human Liver for Transplantation Generated Solely from Induced Pluripotent Stem Cells.
Cell Rep. 2020 Jun 2;31(9):107711.

Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T.
Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases.
PLoS One. 2010 Jan 25;5(1):e8870.
Additional strain information