Usage Restrictions
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The recipient must obey regulations stipulated in the liscence agreement of Sigma-Aldrich Co. LLC.
Gene Affected
interleukin 2 receptor gamma (Il2rg)
Origin
This strain is established by ZFN method targeting rat Il2rg gene. Background strain: F344/Stm
Strain characteristics
This strain shows severe combined immunodeficiency caused by a 660 bp deletion in Il2rg gene and grow normally under SPF condition.
Breeding Conditions
maintained by mating between hemizygous male and homozygous female
Genotyping
Genotyping by PCR analysis.
wild：1509-bp, mutant：849-bp
primers：TCTCCCAGGGGACTTAGCTTA, TGGGACCTGGTGTTAGGTTT
References
Takeishi K, Collin de l'Hortet A, Wang Y, Handa K, Guzman-Lepe J, Matsubara K, Morita K, Jang S, Haep N, Florentino RM, Yuan F, Fukumitsu K, Tobita K, Sun W, Franks J, Delgado ER, Shapiro EM, Fraunhoffer NA, Duncan AW, Yagi H, Mashimo T, Fox IJ, Soto-Gutierrez A.
Assembly and Function of a Bioengineered Human Liver for Transplantation Generated Solely from Induced Pluripotent Stem Cells.
Cell Rep. 2020 Jun 2;31(9):107711.
Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T.
Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases.
PLoS One. 2010 Jan 25;5(1):e8870.