NBRP Rat No: 0586 |
Strain name: F344-Il2rgem2Kyo |
Commmon Name: X-SCID |
Rat Genome Database |
Principal Investigator: |
Tomoji Mashimo The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai-Minatoku-Tokyoto 108-8639 Japan |
Tel: 03-6409-2489 Fax: |
Email: mashimo@ims.u-tokyo.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
|
Inbred Generations |
N1F9 (April 2012) |
Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. The recipient must obey regulations stipulated in the liscence agreement of Sigma-Aldrich Co. LLC. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
interleukin 2 receptor gamma (Il2rg) |
Origin |
This strain is established by ZFN method targeting rat Il2rg gene. Background strain: F344/Stm |
Strain characteristics |
This strain shows severe combined immunodeficiency caused by a 1097-bp deletion in Il2rg gene and grow normally under SPF condition. |
Breeding Conditions |
maintained by mating between hemizygous male and homozygous female |
Genotyping |
primers: TCTCCCAGGGGACTTAGCTTA, TGGGACCTGGTGTTAGGTTT. product size: wild 1509-bp, mutant 412-bp |
References |
Ohno T, Kai T, Miyasaka Y, Maruyama H, Ishih A, Kino H.
Intestinal immunity suppresses carrying capacity of rats for the model tapeworm, Hymenolepis diminuta.
Parasitol Int. 2018 Feb 12. pii: S1383-5769(18)30004-7.
Katsukawa M, Nakajima Y, Fukumoto A, Doi D, Takahashi J.
Fail-safe therapy by gamma-ray irradiation against tumor formation by human induced pluripotent stem cell-derived neural progenitors.
Stem Cells Dev. 2016 Jun 1;25(11):815-25.
Nishimura K, Doi D, Samata B, Murayama S, Tahara T, Onoe H, Takahashi J.
Estradiol Facilitates Functional Integration of iPSC-Derived Dopaminergic Neurons into Striatal Neuronal Circuits via Activation of Integrin α5β1.
Stem Cell Reports. 2016 Apr 12;6(4):511-24.
Yamashita, A., Morioka, M., Yahara, Y., Okada, M., Kobayashi, T., Kuriyama, S., Matsuda, S., and Tsumaki, N.
Generation of Scaffoldless Hyaline Cartilaginous Tissue from Human iPSCs.
Stem Cell Reports. 2015 Mar 10;4(3):404-418
Samata B, Kikuchi T, Miyawaki Y, Morizane A, Mashimo T, Nakagawa M, Okita K, Takahashi J.
X-linked severe combined immunodeficiency (X-SCID) rats for xeno-transplantation and behavioral evaluation.
J Neurosci Methods. 243:68-77, 2015.
Mashimo T, Takizawa A, Kobayashi J, Kunihiro Y, Yoshimi K, Ishida S, Tanabe K, Yanagi A, Tachibana A, Hirose J, Yomoda J, Morimoto S, Kuramoto T, Voigt B, Watanabe T, Hiai H, Tateno C, Komatsu K, Serikawa T.
Generation and characterization of severe combined immunodeficiency rats.
Cell Rep. 2012 Sep 27;2(3):685-94.
Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T.
Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases.
PLoS One. 2010 Jan 25;5(1):e8870. |
Additional strain information |
|
|
|