Strain information

Back to the list 752 / 882

NBRP Rat No: 0894

Strain name: F344-Rag2^em1Iexas

Commmon Name: Rag2 KO

Rat Genome Database

Principal Investigator:

Tomoji Mashimo The University of Tokyo, The Institute of Medical Science

Preservation Status:

Embryo Sperm Living Animals

Coat Color

albio

Inbred Generations

Usage Restrictions

The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.

Genetic Status

Inbred Segregating Congenic Consomic Recombinant Coisogenic Spont. Mutant Transgene Ind. Mutant Category Other

Comercial Availability

Research Category

Diabetes Obesity Neurobiology Ophthalmology Dentistry Cardio Hypertension Cancer Metabolism Otorhinology Immunology Infectious Osteosis Internal Organ Dermatology Reproduction Development Behavior Hematology Urology Pharmacology Research Area Others

Control Strain Marker Strain

Gene Affected

recombination activating 2(Rag2)

Origin

【This strain is provided by the University of Tokyo (cooperative facility)】This strain was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. The off-target sites have not been identified yet.

Strain characteristics

This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition.

Breeding Conditions

Mating male homozygous and female homozygous.

Genotyping

Transgenic rats can be distinguished by PCR, electrophoresis and Sanger sequencing. Rag2: Wilde type: 381bp, Mutant: 382bp, Primer：GGGGAGAAGGTGTCTTACGG, AGGTGGGAGGTAGCAGGAAT

References

Kim JI, Lim HJ, Kwon E, Mashimo T, Kang BC.
Immune deficiency phenotypes of Il2rg, Rag2 or Il2rg/Rag2 double knockout rats; establishment of human leukemia xenograft models.
Lab Anim Res. 2024 Dec 27;40(1):43.

Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T. Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases. PLoS One. 2010 Jan 25;5(1):e8870.

Additional strain information (Japanese only)