Strain information
 NBRP Rat No: 0022  Strain name: VF/Kyo  Commmon Name: VF, vacuole formation rat Rat Genome Database
Principal Investigator:  Tadao Serikawa  Graduate School of Medicine, Kyoto University       Yoshidakonoe-cho, Sakyo-ku    606-8501 Kyoto     JAPAN
Tel: 075-753-4360    Fax: 075-753-4409 Email: serikawa@anim.med.kyoto-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/VF/861a%20(Large).jpg ../images/Photos/VF/861z%20(Large).jpg
Coat Color  albino (c)
Inbred Generations  F41 (May 2009)
Usage Restrictions  
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected
Origin Derived by a spontanious mutation from trm (F26). tm deletion was subsequently replaced by inbreeeding.
Strain characteristics The vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS).We identified a nonsense mutation in the dopey family member 1 (Dopey1) located on rat chromosome 8. Expression level of Dopey1 mRNA was decreased and DOPEY1 protein was undetectable both in the white and gray matter of the spinal cords in the VF rats. DOPEY1 was mainly expressed in neurons and oligodendrocytes in the wild-type rats, whereas no positive cells were detected in the VF rats. We also demonstrated the maturation of oligodendrocytes is disrupted in the VF rats. In addition, proteolipid protein and myelin-associated glycoprotein accumulated in oligodendrocyte cell body, suggesting that Dopey1 is likely to be involved in the traffic of myelin components. Our results highlighted the importance of Dopey1 for the development and maintenance of the CNS myelin.
Breeding Conditions Fertile. Heterozygous female and homozygous or heterozygous male are mated.
Genotyping PCR-RFLP analysis, Amp-FTA method/ Primers F: ATTAAAGCTAGTGCCAGTGAATGGTG, R: GTATGGCTTAAATTCTCGCTGATGT    The 222 bp genomic DNA is subjected to restriction digestion with KpnI. After digestion, two bands (87 and 135 bp) are generated from the wild type genome, and three bands (87, 135, and 222 bp) are generated from the heterozygous genome, but only a single band (222 bp) is detected in the vf homozygous genome(Tanaka et. al, 2014).
References Tanaka M, Izawa T, Yamate J, Franklin RJ, Kuramoto T, Serikawa T, Kuwamura M.
The VF rat with abnormal myelinogenesis has a mutation in Dopey1.
Glia. 62(9):1530-1542, 2014

Tanaka M, Soma K, Izawa T, Yamate J, Franklin RJ, Kuramoto T, Serikawa T, Kuwamura M.
Abnormal myelinogenesis in the central nervous system of the VF mutant rat with recoverable tremor.
Brain Res, 1488: 104-112, 2012

Nakane Y, Adachi T, Voigt B, Yamasaki K, Kaji S, Inui T, Kitada K and Serikawa T.
A novel mutation vf causing abnormal vacuoles in the central nervous system maps on rat chromosome 8.
Exp Anim, 51(2): 149-155, 2002.
Additional strain information VF