Usage Restrictions
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Gene Affected
interleukin 2 receptor gamma (Il2rg), recombination activating 2(Rag2)
Origin
【This strain is provided by the University of Tokyo (cooperative facility)】This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. The off-target sites have not been identified yet.
Strain characteristics
This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late.
Breeding Conditions
Mating male hemizygous and female homozygous.
Genotyping
Transgenic rats can be distinguished by PCR, electrophoresis and Sanger sequencing. Il2rg: Wiled type: 292 bp, Mutant: 287 bp, Primer：TTGCTGACTTCTATGGACCTTAAA, TTCATCTGGTCTGAACTGATAACTTAT, Rag2: Wilde type: 381bp, Mutant: 382bp, Primer：GGGGAGAAGGTGTCTTACGG, AGGTGGGAGGTAGCAGGAAT
References
Joo-Il Kim, Mi-Young Park, Euna Kwon, Tomoji Mashimo, Hyoung Jin Kang, Byeong-Cheol Kang
Validation of a B cell acute lymphoblastic leukemia xenograft rat model for integrated efficacy, pharmacokinetics and safety of CD19 CAR-T
Toxicol Res. 2026 Mar 14.
Gospos J, Laubach M, Savi FM, Ravichandran A, Bauer J, Friedrich O, Holzapfel BM, Wagner F, Mashimo T, Saifzadeh S, Hutmacher DW, McGovern JA.
Dynamic asses sment of a humanized bone tumour microenvironment reveals insights into osteosarcoma primary tumour remodelling and lung metastases.
Sci Rep. 2025 Nov 28;15(1):45619.
Kim JI, Lim HJ, Kwon E, Mashimo T, Kang BC.
Immune deficiency phenotypes of Il2rg, Rag2 or Il2rg/Rag2 double knockout rats; establishment of human leukemia xenograft models.
Lab Anim Res. 2024 Dec 27;40(1):43.
Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T. Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases. PLoS One. 2010 Jan 25;5(1):e8870.