NBRP Rat No: 0561 |
Strain name: ACI.F344-(D16Nkg112-D16Nkg27)/Nkg |
Commmon Name: |
Rat Genome Database |
Principal Investigator: |
Hitoshi Nakagama National Cancer center 5-1-1 Tsukiji, Chuo-ku 104-0045 Tokyo Japan |
Tel: 03-3542-2511 Fax: 03-3542-2530 |
Email: hnakagam@ncc.go.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
agouti |
Inbred Generations |
F3 (Mar 2009) |
Usage Restrictions |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
|
Origin |
F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established by backcrossing ACI.F344-(D16Nkg9-D16Nkg27) onto ACI/N, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. (Jul 7, 2009) |
Strain characteristics |
|
Breeding Conditions |
|
Genotyping |
About D16Nkg27, please refer to http://www.ncc.go.jp/jp/nccri/divisions/02bioc/02bioc01_3.html. About D16Nkg112, the product size is 244bp, forward primer: TGCCTTCTTAACTCTGACGG, reverse primer: GTTAGCCTGCCTCCATTTTT. |
References |
|
Additional strain information |
|
|