Strain information

Back to the list 25 / 882

NBRP Rat No: 0589

Strain name: TM-Il2rg^em5Kyo

Commmon Name: X-SCID

Rat Genome Database

Principal Investigator:

Tomoji Mashimo The University of Tokyo, The Institute of Medical Science

Preservation Status:

Embryo Sperm Living Animals

Coat Color

Inbred Generations

Usage Restrictions

The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The recipient must obey regulations stipulated in the liscence agreement of Sigma-Aldrich Co. LLC.

Genetic Status

Inbred Segregating Congenic Consomic Recombinant Coisogenic Spont. Mutant Transgene Ind. Mutant Category Other

Comercial Availability

Research Category

Diabetes Obesity Neurobiology Ophthalmology Dentistry Cardio Hypertension Cancer Metabolism Otorhinology Immunology Infectious Osteosis Internal Organ Dermatology Reproduction Development Behavior Hematology Urology Pharmacology Research Area Others

Control Strain Marker Strain

Gene Affected

interleukin 2 receptor gamma (Il2rg)

Origin

This strain was established by ZFN method targeting rat Il2rg gene. Background strain: TM/Kyo

Strain characteristics

This strain shows severe combined immunodeficiency caused by a 653-bp deletion in Il2rg gene and grow normally under SPF condition.

Breeding Conditions

maintained by mating between hemizygous male and homozygous female

Genotyping

primers: TCTCCCAGGGGACTTAGCTTA, TGGGACCTGGTGTTAGGTTT. product size: wild 1509-bp, mutant 856-bp

References

Additional strain information (Japanese only)