Japanese
 NBRP Rat No: 0636 Strain Name: W-Tg(Nanog-GFP,-PuroR)22Kyo Commmon Name: nanog-GFP reporter rat
 Principal Investigator  Birger Voigt
 Organization    Graduate School of Medicine, Kyoto University   Institute of Laboratory Animals
 Address  Yoshidakonoe-cho, Sakyo-ku

606-8501 Kyoto

  JAPAN
 Telephone  075-753-9318  Fax:  075-753-4409  birger@anim.med.kyoto-u.ac.jp
 Inbred Generations   F?+3 (April 2012) 
   
 Coat Color
 Deposition Status
 
 albino (A,B,c,h)
  Embryo      Sperm      Live Animals
 Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested. (see references)
For a commercial use of this resource, a new contract must be concluded between the depositor and the RECIPIENT.
The RECIPIENT recognizes and acknowledges that the BIOLOGICAL RESOURCE was created by the scientist at KYOTO UNIVERSITY from Nanog-IRES-Puro mouse by utilizing the Red/ET Recombineering technology of Gene Bridges GmBH. 
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others stem cell research
  Control Strains   Reporter gene Strains  
 Gene Nanog
 Origin mouse Nanog-GFP IRES puromycin resistant BAC was injected into Crlj:WI rat embryos. 4 lines were established of which line 22 showed the best breeding performance 
 Strain Characteristics Nanog-GFP IRES puro-resistance transgene was generated by insertion of GFP-IRES-puromycin resistance gene (Puror) cassette into the 5' untranslated region of a bacterial artificial chromosome (BAC) containing the mouse Nanog gene. ES and iPS cells with the Nanog-GFP transgene are positive for GFP.  
 Breeding Conditions normal breeding performance 
 Genotyping mouse nanog-GFP BAC can be detected using the following primer pair:
PHF5’BamH1 TGGGATCCCTATGCTACTCCGTCGAAGTTC
6047AS10 CTAGGCAAACTGTGGGGACCAGGAAGAC
Annealing 63°C; 30 cycles standard PCR conditions 
 References  Okita, K. et al., Generation of germline-competent induced pluripotent stem cells. Nature 448: 313-317(2007)