Japanese
 NBRP Rat No: 0637 Strain Name: F344.W-Tg(Nanog-GFP,-PuroR)Kyo Commmon Name: nanog-GFP reporter rat
 Principal Investigator  Birger Voigt
 Organization    Graduate School of Medicine, Kyoto University   Institute of Laboratory Animals
 Address  Yoshidakonoe-cho, Sakyo-ku

606-8501 Kyoto

  JAPAN
 Telephone  075-753-9318  Fax:  075-753-4409  birger@anim.med.kyoto-u.ac.jp
 Inbred Generations   N7 (April 2012) 
   
 Coat Color
 Deposition Status
 
 albino (A,B,c,h)
  Embryo      Sperm      Live Animals
 Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested. (see references)
For a commercial use of this resource, a new contract must be concluded between the depositor and the RECIPIENT.
The RECIPIENT recognizes and acknowledges that the BIOLOGICAL RESOURCE was created by the scientist at KYOTO UNIVERSITY from Nanog-IRES-Puro mouse by utilizing the Red/ET Recombineering technology of Gene Bridges GmBH. 
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others stem cell research
  Control Strains   Reporter gene Strains  
 Gene Nanog
 Origin W-Tg(Nanog-GFP,-puro-r)/22Kyo rats were backcrossed to F344/Stm to transfer the transgene onto a different genetic background 
 Strain Characteristics Nanog-GFP IRES puro-resistance transgene was generated by insertion of GFP-IRES-puromycin resistance gene (Puror) cassette into the 5' untranslated region of a bacterial artificial chromosome (BAC) containing the mouse Nanog gene. ES and iPS cells with the Nanog-GFP transgene are positive for GFP.  
 Breeding Conditions normal breeding performance 
 Genotyping mouse nanog-GFP BAC can be detected using the following primer pair:
PHF5’BamH1 TGGGATCCCTATGCTACTCCGTCGAAGTTC
6047AS10 CTAGGCAAACTGTGGGGACCAGGAAGAC
Annealing 63°C; 30 cycles standard PCR conditions 
 References  Okita, K. et al., Generation of germline-competent induced pluripotent stem cells. Nature 448: 313-317(2007)