Japanese
 NBRP Rat No: 0666 Strain NameDA-Tyrem1Kyo Commmon Name: DA albino
 Principal Investigator  Tomoji Mashimo
 Organization    The University of Tokyo, The Institute of Medical Science Laboratory Animal Research Center
 Address  4-6-1 Shirokanedai-Minatoku-Tokyoto

108-8639 

 Japan
 Telephone  03-6409-2489  Fax:    mashimo@ims.u-tokyo.ac.jp
 Inbred Generations   F2 
   
 Coat Color
 Deposition Status
 
 albino
  Embryo      Sperm      Live Animals
 Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. 
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene Tyrosinase
 Origin The strain having a Endonuclease-induced mutation in Tyr gene was established by TAL effector nuclease obtained from Cellectis bioresearch Inc.
 
 Strain Characteristics This rats show albino phyenotype on the DA/Slc background.
 
 Breeding Conditions good breeding performance  
 Genotyping PCR. wild: 260-bp, mutant: 132-bp. primers: TTGCATAAATTGGTTTTCACAGA, ATTTAAACATGAAAATATTACCTTCCA 
 References  Mashimo T, Kaneko T, Sakuma T, Kobayashi J, Kunihiro Y, Voigt B, Yamamoto T, Serikawa T.
Efficient gene targeting by TAL effector nucleases coinjected with exonucleases in zygotes.
Sci Rep. 2013;3:1253.