Japanese
 NBRP Rat No: 0717 Strain Name:  LEA-Tg(Pou5f1-YFP*)3Ncco Commmon Name: Oct4-Venus Tg rat, LEA-esTgN(Oct4/Venus)3NCCRI
 Principal Investigator  Takahiro Ochiya
 Organization   Tokyo Medical University Institute of Medical Science  Department of Molecular and Cellular Medicine
 Address   6-7-1 Nishi-Shinjuku, Shinjyuku-ku,

160-0023  Tokyo

 Japan
 Telephone  03-3342-6111  Fax:    tochiya@tokyo-med.ac.jp
 Inbred Generations   不明 
   
 Coat Color
 Deposition Status
 
 茶色
  Embryo      Sperm      Live Animals
 Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The recipient is requested to cite the literature designated by the DEPOSITOR.
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.  
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene Oct4 (Pou5f1: POU class 5 homeobox 1 ) promoter, Venus (YFP*: Improved version of yellow fluorescent protein)
 Origin This strain was provided from Kyoto Bioresource center.  
 Strain Characteristics Venus fluorescence can be detected in Oct4(Pou5f1)-expressing cells (especially in germ cell and ES cells) 
 Breeding Conditions Mating between Tg rat and wild-type LEA rat. 
 Genotyping PCR analysis, 200-bp
Forward: ACCCTGAAGCTGATCTGCAC
Reverse: GGTCTTGTAGTTGCCGTCGT

KOD version2
94℃: 2 min

98℃: 20 sec
62℃: 20 sec
68℃: 30 sec
(35 cysles)
68℃: 5 min
4℃
 
 References  Kawamata M, Ochiya T. Generation of genetically modified rats from embryonic stem cells. Proc Natl Acad Sci U S A. 2010 Aug 10;107(32):14223-8.

Kawamata M, Ochiya T. Two distinct knockout approaches highlight a critical role for p53 in rat development. Sci Rep 2012 2: 945