| Strain Characteristics |
The vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS).We identified a nonsense mutation in the dopey family member 1 (Dopey1) located on rat chromosome 8. Expression level of Dopey1 mRNA was decreased and DOPEY1 protein was undetectable both in the white and gray matter of the spinal cords in the VF rats. DOPEY1 was mainly expressed in neurons and oligodendrocytes in the wild-type rats, whereas no positive cells were detected in the VF rats. We also demonstrated the maturation of oligodendrocytes is disrupted in the VF rats. In addition, proteolipid protein and myelin-associated glycoprotein accumulated in oligodendrocyte cell body, suggesting that Dopey1 is likely to be involved in the traffic of myelin components. Our results highlighted the importance of Dopey1 for the development and maintenance of the CNS myelin. |
| Genotyping |
PCR-RFLP analysis, Amp-FTA method/ Primers F: ATTAAAGCTAGTGCCAGTGAATGGTG, R: GTATGGCTTAAATTCTCGCTGATGT
The 222 bp genomic DNA is subjected to restriction digestion with KpnI. After digestion, two bands (87 and 135 bp) are generated from the wild type genome, and three bands (87, 135, and 222 bp) are generated from the heterozygous genome, but
only a single band (222 bp) is detected in the vf homozygous genome(Tanaka et. al, 2014). |
| References |
Tanaka M, Izawa T, Yamate J, Franklin RJ, Kuramoto T, Serikawa T, Kuwamura M.
The VF rat with abnormal myelinogenesis has a mutation in Dopey1.
Glia. 62(9):1530-1542, 2014
Tanaka M, Soma K, Izawa T, Yamate J, Franklin RJ, Kuramoto T, Serikawa T, Kuwamura M.
Abnormal myelinogenesis in the central nervous system of the VF mutant rat with recoverable tremor.
Brain Res, 1488: 104-112, 2012
Nakane Y, Adachi T, Voigt B, Yamasaki K, Kaji S, Inui T, Kitada K and Serikawa T.
A novel mutation vf causing abnormal vacuoles in the central nervous system maps on rat chromosome 8.
Exp Anim, 51(2): 149-155, 2002. |