Japanese
 NBRP Rat No: 0022 Strain NameVF/Kyo Commmon Name: VF, vacuole formation rat
 Principal Investigator  Tadao Serikawa
 Organization   Graduate School of Medicine, Kyoto University Institute of Laboratory Animals
 Address  Yoshidakonoe-cho, Sakyo-ku

606-8501 Kyoto

 JAPAN
 Telephone  075-753-4360  Fax:  075-753-4409  serikawa@anim.med.kyoto-u.ac.jp
 Inbred Generations   F41 (May 2009) 
   
 Coat Color
 Deposition Status
 
 albino (c)
  Embryo      Sperm      Live Animals
 Usage Restrictions   
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene
 Origin Derived by a spontanious mutation from trm (F26). tm deletion was subsequently replaced by inbreeeding. 
 Strain Characteristics The vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS).We identified a nonsense mutation in the dopey family member 1 (Dopey1) located on rat chromosome 8. Expression level of Dopey1 mRNA was decreased and DOPEY1 protein was undetectable both in the white and gray matter of the spinal cords in the VF rats. DOPEY1 was mainly expressed in neurons and oligodendrocytes in the wild-type rats, whereas no positive cells were detected in the VF rats. We also demonstrated the maturation of oligodendrocytes is disrupted in the VF rats. In addition, proteolipid protein and myelin-associated glycoprotein accumulated in oligodendrocyte cell body, suggesting that Dopey1 is likely to be involved in the traffic of myelin components. Our results highlighted the importance of Dopey1 for the development and maintenance of the CNS myelin. 
 Breeding Conditions Fertile. Heterozygous female and homozygous or heterozygous male are mated. 
 Genotyping PCR-RFLP analysis, Amp-FTA method/ Primers F: ATTAAAGCTAGTGCCAGTGAATGGTG, R: GTATGGCTTAAATTCTCGCTGATGT   
The 222 bp genomic DNA is subjected to restriction digestion with KpnI. After digestion, two bands (87 and 135 bp) are generated from the wild type genome, and three bands (87, 135, and 222 bp) are generated from the heterozygous genome, but
only a single band (222 bp) is detected in the vf homozygous genome(Tanaka et. al, 2014). 
 References  Tanaka M, Morita C, Izawa T, Yamate J, Franklin RJM, Kuramoto T, Serikawa T, Kuwamura M.
Impaired maturation and differentiation of oligodendrocytes in the vacuole formation myelin mutant rat.
Vet Pathol. 2025 Oct 9:3009858251379486.

Tanaka M, Izawa T, Yamate J, Franklin RJ, Kuramoto T, Serikawa T, Kuwamura M.
The VF rat with abnormal myelinogenesis has a mutation in Dopey1.
Glia. 62(9):1530-1542, 2014

Tanaka M, Soma K, Izawa T, Yamate J, Franklin RJ, Kuramoto T, Serikawa T, Kuwamura M.
Abnormal myelinogenesis in the central nervous system of the VF mutant rat with recoverable tremor.
Brain Res, 1488: 104-112, 2012

Nakane Y, Adachi T, Voigt B, Yamasaki K, Kaji S, Inui T, Kitada K and Serikawa T.
A novel mutation vf causing abnormal vacuoles in the central nervous system maps on rat chromosome 8.
Exp Anim, 51(2): 149-155, 2002.