Japanese
 NBRP Rat No: 0272 Strain Name: F344-Tg(XPO1)1Hik Commmon Name: F344/DuCrj-Tg(XPO1)1Hik, F344/DuCrj-<i>Tg(hCRM1)1Hik</i>, F344/hcrm1
 Principal Investigator  Hisatoshi Shida
 Organization   Hokkaido University Molecular virology, Institute for genetic medicine
 Address  Kita 15 Nishi 7, Kita-ku, Sapporo

060-0815 Hokkaido

  Japan
 Telephone  011-706-7543  Fax:  011-706-7543  hmyy2010@yahoo.co.jp
 Inbred Generations   N5 
   
 Coat Color
 Deposition Status
 
 albino (c)
  Embryo      Sperm      Live Animals
 Usage Restrictions  Use of BIOLOGICAL RESOURCE shall be limited to a collaborative research with the DEPOSITOR. This condition is NOT limited to two-year period after deposition. 
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene XPO1: Exportin 1 (also known as chromosomal maintenance 1 (CRM1))
 Origin F344/DuCrj Tg rat inoculated with human crm1 genome (BAC) 
 Strain Characteristics human CRM1 (XPO1) is ubiquitously expressed. 
 Breeding Conditions Normal growing. Although homozygous female Tg rats are fertile, homozygous male Tg rats are infertile. A Study is ongoing to explore the reason. 
 Genotyping Primer(TGAGGTCAGGAGTTCAGGAT, CTCTGCCTCCTGGGTTCAA), PCR cindition（annealing :69C, extension 15sec, 40 cycle), product size:~150 bp 
 References  Hiroyuki Okada, Xianfeng Zhang, Ismael B Fofana, Mika Nagai, Hajime Suzuki, Takashi Ohashi and Hisatoshi Shida (2009): Synergistic effect of human CycT1 and CRM1 on HIV-1 propagation in rat T cells and macrophages. Retrovirology 6:43

Ryo Takayanagi, Takashi Ohashi, Eizaburo Yamashita , Yohei Kurosaki, Kumiko Tanaka, Yoshiyuki Hakata, Yasumasa Komoda, Satoru Ikeda, Yasuko Tsunetsugu-Yokota, Yuetsu Tanaka, Hisatoshi Shida (2007): Enhanced Replication of Human T-cell Leukemia Virus Type 1 in T Cells from Transgenic Rats Expressing Human CRM1 That Is Regulated in a Natural Manner. J. Virol. 81: 5908-5918