Japanese
 NBRP Rat No: 0442 Strain Name: F344-Tg(CD4)1Hik Commmon Name: F344/DuCrlCrlj-Tg(CD4)1Hik, F344/DuCrlCrlj-<i>Tg(hCD4)1Hik</i>, F344-hCD4
 Principal Investigator  Hisatoshi Shida
 Organization   Hokkaido University Molecular virology, Institute for genetic medicine
 Address  Kita 15 Nishi 7, Kita-ku, Sapporo

060-0815 Hokkaido

  Japan
 Telephone  011-706-7543  Fax:  011-706-7543  hmyy2010@yahoo.co.jp
 Inbred Generations   2 
   
 Coat Color
 Deposition Status
 
 albino (c)
  Embryo      Sperm      Live Animals
 Usage Restrictions  Use of BIOLOGICAL RESOURCE shall be limited to a collaborative research with the DEPOSITOR, this condition is not limited to two-year period of the deposition. 
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene CD4
 Origin A plasmid carrying the genomic region of the human CD4 was introduced to F344/DuCrj. (Nov 5, 2009) 
 Strain Characteristics Normal phenotype. 
 Breeding Conditions normal breeding 
 Genotyping hCD4: Primer(CCTAAGCTGATGCTGAGCTTGAAA, GTCCTTACCCTTGATGTTGGATT), PCR condition（annealing：57C, extension：30sec, 40 cycles）, product size: ~150 bp 
 References