The National BioResource Project for the Rat in Japan

Strain information

Back to the list 373 / 882
NBRP Rat No: 0435
Strain name: F344-Tg(CCNT1)1Hik
Commmon Name: F344/DuCrlCrlj-Tg(CCNT1)1Hik, F344/DuCrlCrlj-Tg(hCyclinT1)1Hik, F344-hCyclinT1
Rat Genome Database
Principal Investigator:
Hisatoshi ShidaHokkaido University
Preservation Status:
Coat Color
albino (c)
Inbred Generations
2
Usage Restrictions
Use of BIOLOGICAL RESOURCE shall be limited to a collaborative research with the DEPOSITOR. This condition is not limited to two-year period of the deposition.
Genetic Status
Comercial Availability
Research Category
Gene Affected
CCNT1: cyclin T1
Origin
A BAC carrying the genomic region of the human cyclin T1 (CCNT1) was introduced to F344/DuCrj. (Nov 5, 2009)
Strain characteristics
Normal phenotype. Because the transgene was integrated into the Chr Y, only male rats are transgenes. (Nov 5, 2009)
Breeding Conditions
Genotyping
hCCNT1:Primer(CCAGTATTGAATATGTACCCTAGGTTTGG, CAACACTGGAAGTTCTGGATAGGCC), 条件（annealing：58C,extension：1 min), product size:~1 Kb
References
Additional strain information (Japanese only)