Japanese
 NBRP Rat No: 0567 Strain NameF344-Trdk/Kyo Commmon Name: Tremor dominant Kyoto, Annin, アンニンラット
 Principal Investigator  Tomoji Mashimo
 Organization    The University of Tokyo, The Institute of Medical Science Laboratory Animal Research Center
 Address  4-6-1 Shirokanedai-Minatoku-Tokyoto

108-8639 

 Japan
 Telephone  03-6409-2489  Fax:    mashimo@ims.u-tokyo.ac.jp
 Inbred Generations   G1 (Apr 2009) 
   
 Coat Color
 Deposition Status
 
 albino (c)
  Embryo      Sperm      Live Animals
 Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. 
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene Kcnn2: potassium calcium-activated channel subfamily N member 2
 Origin Tremor dominant Kyoto (Trdk) is an autosomal dominant mutation that appeared in F344/NSlc rats mutagenized with N-ethyl-N-nitrosourea (ENU)(phenotype driven). This strain exhibited dominantly-inherited body tremor. (Kuramoto st al., 2017.)  
 Strain Characteristics The rats exhibited a tremor that was especially evident around weaning but persisted throughout life. The tremors of F344-Trdk/+ rats were attenuated by drugs effective against essential tremor (ET) but not drugs used to treat Parkinson's disease-related tremor, indicating that the pharmacological phenotype of F344-Trdk/+ rats was similar to human ET. The Trdk mutation was identified as a missense substitution (c. 866 T>A, p. I289N) in Kcnn2 (Kuramoto st al., 2017.) 
 Breeding Conditions Maintained by mating between Trdk/+ and F344/NSlc rats. (Sep, 2017) 
 Genotyping PCR-RFLP method: Primers are rKcnn2-An-F (caatggagcagatgactgga) and rKcnn2-An-R (acagtccatgcggcaattat) (Annealing temperature: 55℃). Product size: 390 bp. After digestion with BsrDI, Trdk allele is cut into 119 and 271 bp bands, but wild-type allele is not digested with KpnI. (Sep, 2017)
 
 References  Kuramoto T, Yokoe M, Kunisawa N, Ohashi K, Miyake T, Higuchi Y, Yoshimi K, Mashimo T, Tanaka M, Kuwamura M, Kaneko S4, Shimizu S, Serikawa T, Ohno Y.
Tremor dominant Kyoto (Trdk) rats carry a missense mutation in the gene encoding the SK2 subunit of small-conductance Ca2+-activated K+ channel.
Brain Res. 2017. 1676: 38-45.