Japanese
 NBRP Rat No: 0561 Strain Name: ACI.F344-(D16Nkg112-D16Nkg27)/Nkg Commmon Name: 
 Principal Investigator  Hitoshi Nakagama
 Organization   National Cancer center  Biochemistry Division
 Address  5-1-1 Tsukiji, Chuo-ku

104-0045 Tokyo

  Japan
 Telephone  03-3542-2511  Fax:  03-3542-2530  hnakagam@ncc.go.jp
 Inbred Generations   F3 (Mar 2009) 
   
 Coat Color
 Deposition Status
 
 agouti
  Embryo      Sperm      Live Animals
 Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.  
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene
 Origin F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established by backcrossing ACI.F344-(<i>D16Nkg9-D16Nkg27</i>) onto ACI/N, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. (Jul 7, 2009) 
 Strain Characteristics  
 Breeding Conditions  
 Genotyping About D16Nkg27, please refer to http://www.ncc.go.jp/jp/nccri/divisions/02bioc/02bioc01_3.html. About D16Nkg112, the product size is 244bp, forward primer: TGCCTTCTTAACTCTGACGG, reverse primer: GTTAGCCTGCCTCCATTTTT. 
 References