Japanese
 NBRP Rat No: 0569 Strain NameSD-Tg(CAG-lacZ)541Htsu Commmon Name: SD-Tg(CALNL-LacZ)541, LacZ541
 Principal Investigator  Hiroyuki Tsuda
 Organization   Nagoya City University Graduate School of Medical Sciences Department of Molecular Toxicology
 Address  1 Kawasumi, Mizuho-cho Mizuho-ku, Nagoya

467-8601 Aichi

 Japan
 Telephone  052-853-8992  Fax:  052-853-8996  htsuda@med.nagoya-cu.ac.jp
 Inbred Generations    
   
 Coat Color
 Deposition Status
 
 albino (c)
  Embryo      Sperm      Live Animals
 Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain prior written consent concerning usage from the DEPOSITOR. The recipient must agree on collaborative research with the DEPOSITOR until publication of literature. This condition is not limited to a two-year period after deposition. After publication, the recipient is requested to cite the literature designated by the DEPOSITOR. 
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene lacZ: beta-galactosidase, E. coli
 Origin This transgenic rat was originated from SD strain. (Oct 30, 2009) LacZ gene expression is controlled by Cre-loxP system. 
 Strain Characteristics The transgene is regulated by the Cre/loxP system. LacZ is driven by CAG promoter. (Oct 30, 2009) 
 Breeding Conditions Maintained in homozygous condition. (Oct 30, 2009) 
 Genotyping primers: 5'- TCTGGATCAAATCCGAACGC -3' and 5'- TCCTGTAGCCAGCTTTCATC -3’,
product size: bp
 
 References  Fukamachi K, Tanaka H, Sakai Y, Alexander DB, Futakuchi M, Tsuda H, Suzui M.
A novel reporter rat strain that expresses LacZ upon Cre-mediated recombination.
Genesis.2013 ;51(4):268-74