Japanese
 NBRP Rat No: 0624 Strain Name: F344-Tg(NC1-269B17)4Nkg Commmon Name: 
 Principal Investigator  Hitoshi Nakagama
 Organization   National Cancer center  Biochemistry Division
 Address  5-1-1 Tsukiji, Chuo-ku

104-0045 Tokyo

  Japan
 Telephone  03-3542-2511  Fax:  03-3542-2530  hnakagam@ncc.go.jp
 Inbred Generations   N4 (Jun 4, 2010) 
   
 Coat Color
 Deposition Status
 
 albino (c)
  Embryo      Sperm      Live Animals
 Usage Restrictions  In publishing, an acknowledgment to the DEPOSITOR is requested.  
 Genetic Status   Inbred   Segregating   Congenic   Consomic    Recombinant 
  Coisogenic   Spont. Mutant    Transgene   Ind. Mutant    Others 
 Comercial Availability   
 Research Category   Diabetes Obesity    Neurobiology    Ophthalmology    Dentistry    Cardio- Hypertension 
  Oncology   Metabolism   Otorhinology    Immunology    Infectious Disease
  Osteology    Internal Medicine   Dermatology   Reproduction    Development
  Behavior    Hematology    Urology   Pharmacology   Others 
  Control Strains   Reporter gene Strains  
 Gene BAC clone: NC1-269B17, Casp3: caspase 3
 Origin BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Caps3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. There are 4 lines which have different copy numbers (NBRP No.0621-0624). (Nov 11, 2010) 
 Strain Characteristics This transgenic rat possesses 30 copies of BAC clone. Hemizygous rat expresses higher level of Casp3 protein in adenocarcinoma of the large intestine than that of wild type rat. This transgenic rat is lower susceptible to PhIP-induced ACF (aberrant crypt foci) formation than the wild-type rat. (Nov 11, 2010) 
 Breeding Conditions This strain is maintained by backcrossing of male transgenic rats into female F344/Jcl. (Nov 11, 2010) 
 Genotyping Genotyping by PCR-RFLP analysis. Forward Primer (gaccataataccagctgtcagtca), Reverse primer (cctctttgactctcccaaattaaa), annealing temp 54℃. The product size of Mbo I digestion is 199- and 640-bp for F344 and 54-, 145- and 640-bp for ACI. (Nov 11, 2010) 
 References